Transcript: Human XM_011533122.1

PREDICTED: Homo sapiens capping actin protein, gelsolin like (CAPG), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CAPG (822)
Length:
1401
CDS:
215..1261

Additional Resources:

NCBI RefSeq record:
XM_011533122.1
NBCI Gene record:
CAPG (822)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091419 GAGTCCCATCTTCAAGCAATT pLKO.1 1222 CDS 100% 10.800 7.560 N Capg n/a
2 TRCN0000029459 CAGGTGGAGATTGTCACTGAT pLKO.1 833 CDS 100% 4.950 3.465 N CAPG n/a
3 TRCN0000343019 CAGGTGGAGATTGTCACTGAT pLKO_005 833 CDS 100% 4.950 3.465 N CAPG n/a
4 TRCN0000029461 CCGAACACTCAGGTGGAGATT pLKO.1 1184 CDS 100% 4.950 3.465 N CAPG n/a
5 TRCN0000342957 CCGAACACTCAGGTGGAGATT pLKO_005 1184 CDS 100% 4.950 3.465 N CAPG n/a
6 TRCN0000029460 TCCTACCTAGTGCTGCACAAT pLKO.1 353 CDS 100% 4.950 3.465 N CAPG n/a
7 TRCN0000343017 TCCTACCTAGTGCTGCACAAT pLKO_005 353 CDS 100% 4.950 3.465 N CAPG n/a
8 TRCN0000029463 GCATTTCACAAGACCTCCACA pLKO.1 584 CDS 100% 2.640 1.848 N CAPG n/a
9 TRCN0000342955 GCATTTCACAAGACCTCCACA pLKO_005 584 CDS 100% 2.640 1.848 N CAPG n/a
10 TRCN0000029462 GCTGATATCTGATGACTGCTT pLKO.1 1042 CDS 100% 2.640 1.848 N CAPG n/a
11 TRCN0000342956 GCTGATATCTGATGACTGCTT pLKO_005 1042 CDS 100% 2.640 1.848 N CAPG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05931 pDONR223 100% 99.9% 99.7% None 1004A>G n/a
2 ccsbBroad304_05931 pLX_304 0% 99.9% 99.7% V5 1004A>G n/a
3 TRCN0000466938 CTGACTCAGCCGCGCGCCGTCCTA pLX_317 43.4% 99.9% 99.7% V5 1004A>G n/a
4 ccsbBroadEn_05932 pDONR223 99.3% 99.8% 99.7% None 813A>C;1004A>G n/a
5 ccsbBroad304_05932 pLX_304 0% 99.8% 99.7% V5 (not translated due to prior stop codon) 813A>C;1004A>G n/a
6 TRCN0000470895 CTAATGCACCCCTCACCGTGAAGT pLX_317 33.6% 99.8% 99.7% V5 (not translated due to prior stop codon) 813A>C;1004A>G n/a
7 TRCN0000480818 TAACAAGCTTTACGTTTGTATAGT pLX_317 33.6% 99.8% 99.7% V5 (not translated due to prior stop codon) 813A>C;1004A>G n/a
Download CSV