Transcript: Human XM_011533165.3

PREDICTED: Homo sapiens heterogeneous nuclear ribonucleoprotein L like (HNRNPLL), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HNRNPLL (92906)
Length:
2103
CDS:
303..2018

Additional Resources:

NCBI RefSeq record:
XM_011533165.3
NBCI Gene record:
HNRNPLL (92906)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533165.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075101 CGACAGGCTCTAGTGGAATTT pLKO.1 636 CDS 100% 13.200 18.480 N HNRNPLL n/a
2 TRCN0000421341 GAATCCGCTTTATCCAATTAC pLKO_005 824 CDS 100% 13.200 18.480 N HNRNPLL n/a
3 TRCN0000075100 GCAAAGTGCAACGTATTGTTA pLKO.1 880 CDS 100% 5.625 7.875 N HNRNPLL n/a
4 TRCN0000075098 GAGAAGAGCATGTTAGAATTT pLKO.1 1957 CDS 100% 13.200 9.240 N HNRNPLL n/a
5 TRCN0000123506 GCCAAAGAATGTGTGACATTT pLKO.1 672 CDS 100% 13.200 9.240 N Hnrnpll n/a
6 TRCN0000075099 GCACTGAATCACTATCAGATA pLKO.1 1773 CDS 100% 4.950 3.465 N HNRNPLL n/a
7 TRCN0000295034 CACTCAATGGAGCTGATATAT pLKO_005 973 CDS 100% 15.000 9.000 N Hnrnpll n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533165.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12983 pDONR223 100% 47.3% 46.2% None (many diffs) n/a
2 ccsbBroad304_12983 pLX_304 0% 47.3% 46.2% V5 (many diffs) n/a
3 TRCN0000476791 TCAAGGTCCTGTTAACATTCCCGA pLX_317 46.1% 47.3% 46.2% V5 (many diffs) n/a
Download CSV