Transcript: Human XM_011533210.3

PREDICTED: Homo sapiens Rho GTPase activating protein 25 (ARHGAP25), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP25 (9938)
Length:
1828
CDS:
76..1194

Additional Resources:

NCBI RefSeq record:
XM_011533210.3
NBCI Gene record:
ARHGAP25 (9938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533210.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047751 CCAAGAGCTACGAAAGGAAAT pLKO.1 927 CDS 100% 10.800 15.120 N ARHGAP25 n/a
2 TRCN0000047752 GCAGCAAAGTACCCAGGGAAA pLKO.1 518 CDS 100% 4.050 2.835 N ARHGAP25 n/a
3 TRCN0000047749 CCTACATGAAATACAGCTGAA pLKO.1 138 CDS 100% 4.050 2.430 N ARHGAP25 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533210.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11434 pDONR223 100% 26.8% 22% None (many diffs) n/a
2 ccsbBroad304_11434 pLX_304 0% 26.8% 22% V5 (many diffs) n/a
3 TRCN0000479463 TGTCAACTCATTCAAAAGTAGCAC pLX_317 25% 26.8% 22% V5 (many diffs) n/a
Download CSV