Construct: ORF TRCN0000479463
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014365.1_s317c1
- Derived from:
- ccsbBroadEn_11434
- DNA Barcode:
- TGTCAACTCATTCAAAAGTAGCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ARHGAP25 (9938)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000479463
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | NM_001166276.2 | 68.5% | 63.8% | (many diffs) |
| 2 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | NM_014882.3 | 68.3% | 63.6% | (many diffs) |
| 3 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_017005423.2 | 66.8% | 61.5% | (many diffs) |
| 4 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_017005424.1 | 66.7% | 61.3% | (many diffs) |
| 5 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | NM_001007231.3 | 66.5% | 61.3% | (many diffs) |
| 6 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | NM_001364819.1 | 66.3% | 61.1% | (many diffs) |
| 7 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | NM_001364821.1 | 65.5% | 60.8% | (many diffs) |
| 8 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_011533207.3 | 65.5% | 60.8% | (many diffs) |
| 9 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_011533208.2 | 65.5% | 60.8% | (many diffs) |
| 10 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_017005425.1 | 60.8% | 55.5% | (many diffs) |
| 11 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | NM_001364820.1 | 60.5% | 55.3% | (many diffs) |
| 12 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | NM_001166277.2 | 60.4% | 55.1% | (many diffs) |
| 13 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_017005428.1 | 59.6% | 55.4% | (many diffs) |
| 14 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_011533209.2 | 48.7% | 41.4% | (many diffs) |
| 15 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_011533210.3 | 26.8% | 22% | (many diffs) |
| 16 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_017005426.1 | 26.8% | 22% | (many diffs) |
| 17 | human | 9938 | ARHGAP25 | Rho GTPase activating prote... | XM_017005427.1 | 26.8% | 22% | (many diffs) |
| 18 | mouse | 232201 | Arhgap25 | Rho GTPase activating prote... | NM_001037727.2 | 56.6% | 56.2% | (many diffs) |
| 19 | mouse | 232201 | Arhgap25 | Rho GTPase activating prote... | NM_175476.4 | 55.3% | 55.7% | (many diffs) |
| 20 | mouse | 232201 | Arhgap25 | Rho GTPase activating prote... | NM_001286610.1 | 47% | 46.7% | (many diffs) |
| 21 | mouse | 232201 | Arhgap25 | Rho GTPase activating prote... | XM_017321530.1 | 43.9% | 43.8% | (many diffs) |
| 22 | mouse | 232201 | Arhgap25 | Rho GTPase activating prote... | NR_104483.1 | 29.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1440
- ORF length:
- 1374
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc cctcggtcag tcggcctgtc tgttcctctc tatagctcgg tcaaggagtg 121 tgatgactgg cgagcagatg gctgccttcc atccatcgtc cacccccaac ccgctggaga 181 ggcccatcaa gatgggctgg ctgaagaagc agaggtccat cgtgaagaac tggcagcaga 241 ggtactttgt gctgagggcg cagcagctct actactacaa ggatgaagag gacacgaagc 301 cccagggctg catgtatcta ccaggatgta caatcaagga gatcgccaca aacccagaag 361 aagctgggaa gtttgtcttt gaaatcattc cagcctcatg ggaccagaat cgcatgggac 421 aggactccta tgtcctcatg gccagctctc aggcggagat ggaggagtgg gttaaattcc 481 tcaggagagt tgctggcaca ccctgtggag cagtgtttgg ccagcgcttg gatgagactg 541 tggcctatga acagaaattc ggcccccatc tggtgcccat cctggtggag aaatgtgcag 601 agttcatcct ggagcacggc cggaatgaag agggcatctt ccgtctgcct gggcaggaca 661 acctggtgaa gcagctgaga gacgcttttg atgctgggga gcggccctcc tttgacagag 721 acacagatgt gcacactgtg gcttccctgt taaagctcta cctccgagac ctcccagagc 781 ccgtggttcc ctggagccag tacgaagggt tcctgctctg tgggcagctc acgaatgcgg 841 atgaggcaaa ggctcagcag gagttgatga agcagctctc catccttcct cgtgacaact 901 atagtctcct gagctacatc tgcaggttcc tacatgaaat acagctgaac tgtgctgtta 961 acaagatgag tgtggacaac ctggctactg tgattggtgt gaatctcatc aggtcgaagg 1021 tcgaagaccc tgccgtgatc atgagaggga ctcctcagat ccaaagagtg atgactatga 1081 tgatcagaga ccatgaagtc cTCTTCCCCA AGTCCAAGGA TATACCCCTG TCACCCCCTG 1141 CCCAGAAAAA TGACCCCAAG AAAGCTCCAG TGGCCCGAAG CTCTGTAGGC TGGGATGCCA 1201 CTGAAGACCT CCGAATTTCT AGGACAGACA GCTTCAGTAG CATGGTAAGG TGCAGAGAAC 1261 CTTCCTGCTT CCATTGGGTT CTTCCTTTAG TCCAGGCCAT CCCATGTAAG GCCTGCTCTC 1321 GGGTGGCAAT TTGGGGAGTT TTAGGTGATG CAGTGGCAGT GGGCGCTGCT GCTACAGACT 1381 CATCTGAACA CACCTTGAAA GCCTGGCCTC TTTCCAAATC TAGTTTCTAT TGGCATCTTT 1441 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1501 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1561 TTTATATATC TTGTGGAAAG GACGATGTCA ACTCATTCAA AAGTAGCACA CGCGTTAAGT 1621 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt