Transcript: Human XM_011533416.3

PREDICTED: Homo sapiens CKLF like MARVEL transmembrane domain containing 8 (CMTM8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CMTM8 (152189)
Length:
1227
CDS:
283..873

Additional Resources:

NCBI RefSeq record:
XM_011533416.3
NBCI Gene record:
CMTM8 (152189)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533416.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241571 TGCTGGTATGGACGCTTATTG pLKO_005 509 CDS 100% 13.200 18.480 N CMTM8 n/a
2 TRCN0000163379 GACGCTTATTGCTGGAACTGA pLKO.1 519 CDS 100% 3.000 4.200 N CMTM8 n/a
3 TRCN0000159058 GCAAAGTGTTGTAGCTTATAA pLKO.1 1044 3UTR 100% 15.000 10.500 N CMTM8 n/a
4 TRCN0000241572 ATATTCCCAGAGAATTGTATT pLKO_005 946 3UTR 100% 13.200 9.240 N CMTM8 n/a
5 TRCN0000241573 CACCGTCTTCTTCCTCATTAT pLKO_005 600 CDS 100% 13.200 9.240 N CMTM8 n/a
6 TRCN0000241570 CAGGACCATACAGTGATTTAC pLKO_005 858 CDS 100% 13.200 9.240 N CMTM8 n/a
7 TRCN0000159016 GCTACGCTGGAAATACATATT pLKO.1 815 CDS 100% 13.200 9.240 N CMTM8 n/a
8 TRCN0000164390 CCGCTGTTGTAGATGCATCTT pLKO.1 716 CDS 100% 4.950 3.465 N CMTM8 n/a
9 TRCN0000160251 CTCACAAATTGTGGTTTGTTA pLKO.1 1001 3UTR 100% 0.563 0.394 N CMTM8 n/a
10 TRCN0000158721 GCTCACAAATTGTGGTTTGTT pLKO.1 1000 3UTR 100% 0.563 0.394 N CMTM8 n/a
11 TRCN0000241569 CATTTGGCTGGGTCATGTTTG pLKO_005 557 CDS 100% 10.800 6.480 N CMTM8 n/a
12 TRCN0000164561 CTCACCGTCTTCTTCCTCATT pLKO.1 598 CDS 100% 4.950 2.970 N CMTM8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533416.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09682 pDONR223 100% 87.7% 87.2% None (many diffs) n/a
2 ccsbBroad304_09682 pLX_304 0% 87.7% 87.2% V5 (many diffs) n/a
3 TRCN0000467687 AATCACCCGCAGAAGCTTTCGACG pLX_317 81% 87.7% 87.2% V5 (many diffs) n/a
Download CSV