Transcript: Human XM_011533531.1

PREDICTED: Homo sapiens raftlin, lipid raft linker 1 (RFTN1), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RFTN1 (23180)
Length:
3283
CDS:
575..1957

Additional Resources:

NCBI RefSeq record:
XM_011533531.1
NBCI Gene record:
RFTN1 (23180)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127814 GAGCTTGGTACGGTTGAAGAA pLKO.1 2274 3UTR 100% 4.950 6.930 N RFTN1 n/a
2 TRCN0000128842 GCCTGAAATTCGTTGGTGTTA pLKO.1 1143 CDS 100% 4.950 6.930 N RFTN1 n/a
3 TRCN0000130387 GCGATTCTCCAGAGAAGAAAT pLKO.1 1904 CDS 100% 13.200 9.240 N RFTN1 n/a
4 TRCN0000130134 CGACTCTTCTGCTTTGACAAA pLKO.1 2796 3UTR 100% 4.950 3.465 N RFTN1 n/a
5 TRCN0000129924 GACAAACAACAAGCAGAAGAA pLKO.1 1971 3UTR 100% 4.950 3.465 N RFTN1 n/a
6 TRCN0000127713 GAGTGTATCCACCAAGCAGAT pLKO.1 1820 CDS 100% 4.050 2.835 N RFTN1 n/a
7 TRCN0000130852 GCAATACTACCCTGTCACCAT pLKO.1 1558 CDS 100% 2.640 1.848 N RFTN1 n/a
8 TRCN0000130642 CCAGAAACTCATCCCAGAGTT pLKO.1 1090 CDS 100% 0.495 0.347 N RFTN1 n/a
9 TRCN0000177755 CCCAGAGTTCATTAAGAAGGT pLKO.1 1102 CDS 100% 2.640 1.584 N Rftn1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533531.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02729 pDONR223 100% 63.5% 51.6% None (many diffs) n/a
2 ccsbBroad304_02729 pLX_304 0% 63.5% 51.6% V5 (many diffs) n/a
3 TRCN0000474132 AATAATAGACAAATGTTTAACCGG pLX_317 29.3% 63.5% 51.6% V5 (many diffs) n/a
Download CSV