Transcript: Human XM_011533636.1

PREDICTED: Homo sapiens glutamate metabotropic receptor 2 (GRM2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRM2 (2912)
Length:
4487
CDS:
1911..3983

Additional Resources:

NCBI RefSeq record:
XM_011533636.1
NBCI Gene record:
GRM2 (2912)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009012 CTGCACGCTTTATGCCTTCAA pLKO.1 3587 CDS 100% 4.950 6.930 N GRM2 n/a
2 TRCN0000009013 CACTGCCATCACTGGTGTTAT pLKO.1 2309 CDS 100% 13.200 10.560 N GRM2 n/a
3 TRCN0000378254 ACCGCTTTGGTGATGGTATTG pLKO_005 2695 CDS 100% 10.800 8.640 N GRM2 n/a
4 TRCN0000378324 TTGTGCTCAACGTCAAGTTTG pLKO_005 2629 CDS 100% 10.800 8.640 N GRM2 n/a
5 TRCN0000009011 CTACTGCATGACCTTCATCTT pLKO.1 3212 CDS 100% 4.950 3.465 N GRM2 n/a
6 TRCN0000009014 CCATCTTCTATGTCACCTCCA pLKO.1 3697 CDS 100% 2.160 1.512 N GRM2 n/a
7 TRCN0000011671 CCCTTGGAACAACAGCCGGAA pLKO.1 2369 CDS 100% 0.720 0.504 N GRM2 n/a
8 TRCN0000378264 GCTGGAGCACTGCAATAATTT pLKO_005 4062 3UTR 100% 15.000 9.000 N GRM2 n/a
9 TRCN0000378328 AGATCATGTTTGTGGTCAATG pLKO_005 2494 CDS 100% 10.800 6.480 N GRM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533636.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489033 AAACGATTACCACGTACTCTGTGC pLX_317 14.8% 79.1% 79.1% V5 (not translated due to prior stop codon) 445_446ins546 n/a
2 TRCN0000488984 GCTCTGCAATATGTCCCCTAACAA pLX_317 12.1% 79% 79% V5 445_446ins546;2070_2071insG n/a
3 TRCN0000488215 GGACTACGACGTGACCTAGTCAAG pLX_317 12.2% 79% 78.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV