Transcript: Human XM_011533785.2

PREDICTED: Homo sapiens chromosome 3 open reading frame 18 (C3orf18), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C3orf18 (51161)
Length:
2400
CDS:
274..774

Additional Resources:

NCBI RefSeq record:
XM_011533785.2
NBCI Gene record:
C3orf18 (51161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011533785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436922 GTTTACCGATGTGGCCAATGC pLKO_005 741 CDS 100% 4.050 5.670 N C3orf18 n/a
2 TRCN0000162494 CACCTTTAATGACACCAGAAT pLKO.1 399 CDS 100% 4.950 3.465 N C3orf18 n/a
3 TRCN0000165646 GCTCATGCCCATGTACAACTT pLKO.1 567 CDS 100% 4.950 3.465 N C3orf18 n/a
4 TRCN0000165846 GCTTCTGTCCTTTGGGATCAT pLKO.1 459 CDS 100% 4.950 3.465 N C3orf18 n/a
5 TRCN0000166347 CCAAGTTATAGGGACAGGGTA pLKO.1 1228 3UTR 100% 2.640 1.848 N C3orf18 n/a
6 TRCN0000163843 CCTGCTGACTTTAGACTCTAA pLKO.1 924 3UTR 100% 4.950 2.970 N C3orf18 n/a
7 TRCN0000165293 GAAGAAGAAGAGGCTGGAGAA pLKO.1 534 CDS 100% 4.050 2.430 N C3orf18 n/a
8 TRCN0000421086 GACCTACTCTGAAGATCTTCC pLKO_005 852 3UTR 100% 4.050 2.430 N C3orf18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011533785.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08235 pDONR223 100% 97.3% 96.9% None 234_245del;497C>T n/a
2 ccsbBroad304_08235 pLX_304 0% 97.3% 96.9% V5 234_245del;497C>T n/a
3 TRCN0000469324 AGCTTGTGTCGATATTCCGTCGAG pLX_317 78.2% 97.3% 96.9% V5 234_245del;497C>T n/a
Download CSV