Transcript: Human XM_011534168.3

PREDICTED: Homo sapiens doublecortin like kinase 3 (DCLK3), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCLK3 (85443)
Length:
5160
CDS:
492..2270

Additional Resources:

NCBI RefSeq record:
XM_011534168.3
NBCI Gene record:
DCLK3 (85443)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381383 ACTTACGTAGCTCCCGAAATT pLKO_005 2043 CDS 100% 13.200 18.480 N DCLK3 n/a
2 TRCN0000199701 CTTACGTAGCTCCCGAAATTC pLKO.1 2044 CDS 100% 13.200 18.480 N DCLK3 n/a
3 TRCN0000381428 GGTGCTTACCAGGGTCTAAAC pLKO_005 2584 3UTR 100% 10.800 15.120 N DCLK3 n/a
4 TRCN0000199092 CGAGGAGCTTTCACTAGATGA pLKO.1 731 CDS 100% 4.950 6.930 N DCLK3 n/a
5 TRCN0000273880 GTTGTGGAGCAGGTATCATAG pLKO_005 2250 CDS 100% 10.800 8.640 N DCLK3 n/a
6 TRCN0000021556 CCTCGGGTGAAATTATCAGAT pLKO.1 886 CDS 100% 4.950 3.960 N DCLK3 n/a
7 TRCN0000273824 GCATGTGGTGAGACCTATATT pLKO_005 2003 CDS 100% 15.000 10.500 N DCLK3 n/a
8 TRCN0000273826 GGGAGAGACACTGAGTATATT pLKO_005 2384 3UTR 100% 15.000 10.500 N DCLK3 n/a
9 TRCN0000021558 CCGTGTGAGGAAACTGTTTAA pLKO.1 407 5UTR 100% 13.200 9.240 N DCLK3 n/a
10 TRCN0000021557 GCCTATGCGATGAAGATCATT pLKO.1 1632 CDS 100% 5.625 3.938 N DCLK3 n/a
11 TRCN0000273822 GCCTATGCGATGAAGATCATT pLKO_005 1632 CDS 100% 5.625 3.938 N DCLK3 n/a
12 TRCN0000021554 CCCAGCAGAAATTCAAGCATA pLKO.1 4658 3UTR 100% 4.950 3.465 N DCLK3 n/a
13 TRCN0000021555 CCCGAAATTCTTTCTGAGAAA pLKO.1 2055 CDS 100% 4.950 3.465 N DCLK3 n/a
14 TRCN0000273825 TACCTTGAAATTGGCTGATTT pLKO_005 1970 CDS 100% 0.000 0.000 N DCLK3 n/a
15 TRCN0000024452 GTCCACATGCACGACAAGAAT pLKO.1 1887 CDS 100% 5.625 4.500 N Dclk3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534168.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487946 CTGCTCTTCAAAACTCCCCGCTCG pLX_317 14.8% 90.5% 2.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000488114 GCATGCCATCTCCAACTCCATACA pLX_317 14.7% 90.5% 2.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV