Transcript: Human XM_011534266.3

PREDICTED: Homo sapiens ectonucleoside triphosphate diphosphohydrolase 3 (ENTPD3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ENTPD3 (956)
Length:
3159
CDS:
93..944

Additional Resources:

NCBI RefSeq record:
XM_011534266.3
NBCI Gene record:
ENTPD3 (956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000359354 ATGGATTACAGCCAACTATTT pLKO_005 650 CDS 100% 13.200 18.480 N ENTPD3 n/a
2 TRCN0000050449 CCAGGACTGAAGTATGGTATT pLKO.1 249 CDS 100% 10.800 7.560 N ENTPD3 n/a
3 TRCN0000050450 GCCAACTATTTAATGGGAAAT pLKO.1 660 CDS 100% 10.800 7.560 N ENTPD3 n/a
4 TRCN0000080762 TGGATGGATTACAGCCAACTA pLKO.1 647 CDS 100% 4.950 3.465 N Entpd3 n/a
5 TRCN0000080759 GCTCAAATCATTTCTGGGCAA pLKO.1 612 CDS 100% 2.160 1.512 N Entpd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534266.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10718 pDONR223 100% 61.7% 61.5% None (many diffs) n/a
2 ccsbBroad304_10718 pLX_304 0% 61.7% 61.5% V5 (many diffs) n/a
3 TRCN0000470626 ACGCGGTACCCCGTTATCCACAGT pLX_317 36.7% 61.7% 61.5% V5 (many diffs) n/a
Download CSV