Transcript: Human XM_011534494.1

PREDICTED: Homo sapiens zinc finger protein 346 (ZNF346), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF346 (23567)
Length:
2727
CDS:
5..958

Additional Resources:

NCBI RefSeq record:
XM_011534494.1
NBCI Gene record:
ZNF346 (23567)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219819 CCATGGAATGGAGACATTAAA pLKO.1 400 CDS 100% 15.000 21.000 N ZNF346 n/a
2 TRCN0000240712 TTTGCTGCGCCTTGCTTATTT pLKO_005 309 CDS 100% 15.000 21.000 N ZNF346 n/a
3 TRCN0000180587 GCTCAAACTAATGGCACGCTA pLKO.1 772 CDS 100% 2.640 3.696 N ZNF346 n/a
4 TRCN0000099259 AGTGAAGAGATACCTAGCAAT pLKO.1 379 CDS 100% 4.950 3.960 N Zfp346 n/a
5 TRCN0000316265 AGTGAAGAGATACCTAGCAAT pLKO_005 379 CDS 100% 4.950 3.960 N Zfp346 n/a
6 TRCN0000240716 GACCCACGCAAAGAACTTAAA pLKO_005 547 CDS 100% 13.200 9.240 N ZNF346 n/a
7 TRCN0000240713 AGCCTCTGCCATGCAACTTTC pLKO_005 689 CDS 100% 10.800 7.560 N ZNF346 n/a
8 TRCN0000240715 TCCCAGAAGCTGGCACATTAC pLKO_005 335 CDS 100% 10.800 7.560 N ZNF346 n/a
9 TRCN0000147001 CACCAGAATAGAGAGATGATA pLKO.1 650 CDS 100% 5.625 3.938 N ZNF346 n/a
10 TRCN0000179045 CCAGAAGAACCAATGTCTCTT pLKO.1 268 CDS 100% 4.950 3.465 N ZNF346 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02797 pDONR223 100% 75.4% 71.5% None (many diffs) n/a
2 ccsbBroad304_02797 pLX_304 0% 75.4% 71.5% V5 (many diffs) n/a
3 TRCN0000468508 CTTGTGGTGCACCTCTCTAACCGC pLX_317 31.8% 75.4% 71.5% V5 (many diffs) n/a
Download CSV