Transcript: Human XM_011534570.1

PREDICTED: Homo sapiens ubiquitin interaction motif containing 1 (UIMC1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UIMC1 (51720)
Length:
1761
CDS:
133..1746

Additional Resources:

NCBI RefSeq record:
XM_011534570.1
NBCI Gene record:
UIMC1 (51720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060428 CCCACAAAGATTGAACGACAT pLKO.1 1672 CDS 100% 4.050 5.670 N UIMC1 n/a
2 TRCN0000060430 CCGCTATGTGACCAATGCTTT pLKO.1 1648 CDS 100% 4.950 3.960 N UIMC1 n/a
3 TRCN0000303787 TTGAGAATGTGAACGTTAAAT pLKO_005 758 CDS 100% 15.000 10.500 N UIMC1 n/a
4 TRCN0000060429 CCATTGCTGAAAGCCTGAATA pLKO.1 470 CDS 100% 13.200 9.240 N UIMC1 n/a
5 TRCN0000299976 CCATTGCTGAAAGCCTGAATA pLKO_005 470 CDS 100% 13.200 9.240 N UIMC1 n/a
6 TRCN0000303839 CTCTGCCAGTTGGAGGTTTAT pLKO_005 1021 CDS 100% 13.200 9.240 N UIMC1 n/a
7 TRCN0000303784 TGAGAAGGAAGTAGCTATTTC pLKO_005 1596 CDS 100% 13.200 9.240 N UIMC1 n/a
8 TRCN0000060431 GCTCACATATCAGTCAGGGAA pLKO.1 632 CDS 100% 2.640 1.848 N UIMC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12013 pDONR223 100% 51.1% 51% None (many diffs) n/a
2 ccsbBroad304_12013 pLX_304 0% 51.1% 51% V5 (many diffs) n/a
3 TRCN0000477654 AACCACGTCATAGCAGGAAAACCG pLX_317 27.3% 51.1% 51% V5 (many diffs) n/a
Download CSV