Transcript: Human XM_011534645.2

PREDICTED: Homo sapiens zinc finger protein 354A (ZNF354A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF354A (6940)
Length:
2990
CDS:
832..2523

Additional Resources:

NCBI RefSeq record:
XM_011534645.2
NBCI Gene record:
ZNF354A (6940)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000329892 TCTCAGTACATCCCTTTATAA pLKO_005 1545 CDS 100% 15.000 21.000 N ZNF354A n/a
2 TRCN0000015331 CAACGCAAACACAAGACTCTT pLKO.1 992 CDS 100% 4.950 6.930 N ZNF354A n/a
3 TRCN0000015332 CTCTCAGTACATCCCTTTATA pLKO.1 1544 CDS 100% 15.000 10.500 N ZNF354A n/a
4 TRCN0000015329 GCCCAAAGTCAGTGCTTATTA pLKO.1 1211 CDS 100% 15.000 10.500 N ZNF354A n/a
5 TRCN0000329894 TTAGCCCTCATTAGGTATTTA pLKO_005 2629 3UTR 100% 15.000 10.500 N ZNF354A n/a
6 TRCN0000329890 AGCCCAAAGTCAGTGCTTATT pLKO_005 1210 CDS 100% 13.200 9.240 N ZNF354A n/a
7 TRCN0000329891 CAAACACAAGACTCTTCATTT pLKO_005 997 CDS 100% 13.200 9.240 N ZNF354A n/a
8 TRCN0000329814 ATCCCTTTCTGGATGTCAAAG pLKO_005 1722 CDS 100% 10.800 7.560 N ZNF354A n/a
9 TRCN0000015328 GCCCTCATTAGGTATTTAATT pLKO.1 2632 3UTR 100% 15.000 9.000 N ZNF354A n/a
10 TRCN0000015330 CAGCTCTTATTCAGCATCGAA pLKO.1 2309 CDS 100% 3.000 1.800 N ZNF354A n/a
11 TRCN0000164124 CTGGAGAGAAACCCTACATAT pLKO.1 1499 CDS 100% 13.200 6.600 Y ZNF718 n/a
12 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 2424 CDS 100% 13.200 6.600 Y Zfp977 n/a
13 TRCN0000413960 CACACTGGAGAGAAGCCTTAC pLKO_005 1831 CDS 100% 6.000 3.000 Y Zfp612 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534645.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07038 pDONR223 100% 92.9% 92.8% None 0_1ins126;642T>C;771A>C n/a
2 ccsbBroad304_07038 pLX_304 0% 92.9% 92.8% V5 0_1ins126;642T>C;771A>C n/a
3 TRCN0000478640 TACATCAATAACCCCTTTTATCCG pLX_317 16% 92.9% 92.8% V5 0_1ins126;642T>C;771A>C n/a
Download CSV