Transcript: Human XM_011534797.3

PREDICTED: Homo sapiens DNA polymerase epsilon, catalytic subunit (POLE), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
POLE (5426)
Length:
6232
CDS:
95..6070

Additional Resources:

NCBI RefSeq record:
XM_011534797.3
NBCI Gene record:
POLE (5426)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052974 CGCTCCAACATGGTCTACAAT pLKO.1 3341 CDS 100% 5.625 3.938 N POLE n/a
2 TRCN0000052976 CCTGTGTAAAGACTCTTCCTT pLKO.1 5677 CDS 100% 3.000 1.800 N POLE n/a
3 TRCN0000120311 CGCCATATCTACCTGTACCAT pLKO.1 3626 CDS 100% 3.000 2.100 N Pole n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534797.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11042 pDONR223 100% 17% 15.8% None (many diffs) n/a
2 ccsbBroad304_11042 pLX_304 0% 17% 15.8% V5 (many diffs) n/a
3 TRCN0000466721 CGACTGACGATCACGCATCGCGTC pLX_317 25.6% 17% 15.8% V5 (many diffs) n/a
Download CSV