Transcript: Human XM_011534995.2

PREDICTED: Homo sapiens ligand of numb-protein X 2 (LNX2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LNX2 (222484)
Length:
4435
CDS:
310..2013

Additional Resources:

NCBI RefSeq record:
XM_011534995.2
NBCI Gene record:
LNX2 (222484)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011534995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429555 GACATGATTGTGGCCGTAAAT pLKO_005 1885 CDS 100% 13.200 18.480 N LNX2 n/a
2 TRCN0000007746 GCAACGAAACACCTTTGATTA pLKO.1 1064 CDS 100% 13.200 18.480 N LNX2 n/a
3 TRCN0000007745 CCACTAACCTTTGTGAGTTTA pLKO.1 2216 3UTR 100% 13.200 10.560 N LNX2 n/a
4 TRCN0000011197 CGGCATTGATTTGACCAATTT pLKO.1 1509 CDS 100% 13.200 10.560 N LNX2 n/a
5 TRCN0000417044 AGTCACTCTGACCGTTATTTG pLKO_005 1971 CDS 100% 13.200 9.240 N LNX2 n/a
6 TRCN0000414513 GATGTCAGCAAAGCCAGTAAC pLKO_005 2389 3UTR 100% 10.800 7.560 N LNX2 n/a
7 TRCN0000412701 TTGTCATCCAGGAGGTCTATC pLKO_005 1088 CDS 100% 10.800 7.560 N LNX2 n/a
8 TRCN0000007748 GTTCATAAACTCCTAGACAAA pLKO.1 616 CDS 100% 4.950 3.465 N LNX2 n/a
9 TRCN0000418344 CACACACCACCACCGTATTAT pLKO_005 1267 CDS 100% 15.000 9.000 N LNX2 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2731 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2731 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011534995.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05271 pDONR223 100% 82.1% 82.1% None 850_851ins369 n/a
2 ccsbBroad304_05271 pLX_304 0% 82.1% 82.1% V5 850_851ins369 n/a
3 TRCN0000473509 AATTCCCTCATTAGGCCCCATGCG pLX_317 21.2% 82.1% 82.1% V5 850_851ins369 n/a
Download CSV