Transcript: Human XM_011535171.2

PREDICTED: Homo sapiens RB transcriptional corepressor 1 (RB1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RB1 (5925)
Length:
4352
CDS:
17..2542

Additional Resources:

NCBI RefSeq record:
XM_011535171.2
NBCI Gene record:
RB1 (5925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000295892 GTGCGCTCTTGAGGTTGTAAT pLKO_005 1219 CDS 100% 13.200 18.480 N RB1 n/a
2 TRCN0000295891 TCGCTTGTATTACCGAGTAAT pLKO_005 1105 CDS 100% 13.200 18.480 N RB1 n/a
3 TRCN0000010419 CAGAGATCGTGTATTGAGATT pLKO.1 4201 3UTR 100% 4.950 6.930 N RB1 n/a
4 TRCN0000295842 CAGAGATCGTGTATTGAGATT pLKO_005 4201 3UTR 100% 4.950 6.930 N RB1 n/a
5 TRCN0000010418 GACTTCTACTCGAACACGAAT pLKO.1 2467 CDS 100% 4.950 6.930 N RB1 n/a
6 TRCN0000295841 GACTTCTACTCGAACACGAAT pLKO_005 2467 CDS 100% 4.950 6.930 N RB1 n/a
7 TRCN0000040167 CGAAATTGGATCACAGCGATA pLKO.1 1072 CDS 100% 4.050 5.670 N RB1 n/a
8 TRCN0000040164 CGCGTGTAAATTCTACTGCAA pLKO.1 1614 CDS 100% 2.640 3.696 N RB1 n/a
9 TRCN0000040166 CCTCCCATGTTGCTCAAAGAA pLKO.1 446 CDS 100% 5.625 3.938 N RB1 n/a
10 TRCN0000040163 CCACATTATTTCTAGTCCAAA pLKO.1 3692 3UTR 100% 4.950 3.465 N RB1 n/a
11 TRCN0000288710 CCACATTATTTCTAGTCCAAA pLKO_005 3692 3UTR 100% 4.950 3.465 N RB1 n/a
12 TRCN0000040165 CGGCTAAATACACTTTGTGAA pLKO.1 1736 CDS 100% 4.950 3.465 N RB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535171.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06846 pDONR223 99.7% 90.5% 90.5% None 1_1delAins262 n/a
2 ccsbBroad304_06846 pLX_304 22.8% 90.5% 90.5% V5 1_1delAins262 n/a
Download CSV