Transcript: Human XM_011535263.2

PREDICTED: Homo sapiens diaphanous related formin 3 (DIAPH3), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DIAPH3 (81624)
Length:
4079
CDS:
163..2376

Additional Resources:

NCBI RefSeq record:
XM_011535263.2
NBCI Gene record:
DIAPH3 (81624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153101 GCTTGTATGCAGCTCATCAAT pLKO.1 1180 CDS 100% 5.625 7.875 N DIAPH3 n/a
2 TRCN0000153579 GTTAAACTTCTCTCTGCGGTA pLKO.1 1027 CDS 100% 2.160 1.728 N DIAPH3 n/a
3 TRCN0000414550 GCTGATTCGAAATGATTATTT pLKO_005 1497 CDS 100% 15.000 10.500 N DIAPH3 n/a
4 TRCN0000422757 TGGCCTGGATATCCAACTTAA pLKO_005 1311 CDS 100% 13.200 9.240 N DIAPH3 n/a
5 TRCN0000151078 GCATGAGAAGATTGAATTGGT pLKO.1 2096 CDS 100% 3.000 2.100 N DIAPH3 n/a
6 TRCN0000151516 CATCTCCTGATGATTTGGATT pLKO.1 1211 CDS 100% 4.950 2.970 N DIAPH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535263.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04249 pDONR223 100% 41% 39% None (many diffs) n/a
2 ccsbBroad304_04249 pLX_304 0% 41% 39% V5 (many diffs) n/a
3 TRCN0000491728 CTGAGATAATATTGGGAATCTTCT pLX_317 12.8% 41% 39% V5 (many diffs) n/a
Download CSV