Transcript: Human XM_011535419.2

PREDICTED: Homo sapiens transmembrane protein 200A (TMEM200A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TMEM200A (114801)
Length:
3082
CDS:
81..1556

Additional Resources:

NCBI RefSeq record:
XM_011535419.2
NBCI Gene record:
TMEM200A (114801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000166888 CCAGATATACTTAGGGATAAA pLKO.1 2200 3UTR 100% 13.200 18.480 N TMEM200A n/a
2 TRCN0000136427 CGTTAGATACTCGGAATCAAA pLKO.1 2249 3UTR 100% 5.625 7.875 N TMEM200A n/a
3 TRCN0000137787 GTTCAGGCAGAACAACGGAAA pLKO.1 1305 CDS 100% 4.050 5.670 N TMEM200A n/a
4 TRCN0000433621 AGTCAGTACAAGTCATCTATG pLKO_005 1149 CDS 100% 10.800 8.640 N TMEM200A n/a
5 TRCN0000137959 GCAAAGGCAAATGAACGGCAT pLKO.1 611 CDS 100% 2.160 1.728 N TMEM200A n/a
6 TRCN0000423318 GTAGGATTTGGTTACATTATT pLKO_005 2014 3UTR 100% 15.000 10.500 N TMEM200A n/a
7 TRCN0000422304 GAGTGCTCATCTCCATTATAG pLKO_005 283 CDS 100% 13.200 9.240 N TMEM200A n/a
8 TRCN0000135364 GAGGAGGATGAACTTATGTTA pLKO.1 759 CDS 100% 5.625 3.938 N TMEM200A n/a
9 TRCN0000167825 GCTCATCTCCATTATAGGAAT pLKO.1 287 CDS 100% 4.950 3.465 N TMEM200A n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2 5UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535419.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09401 pDONR223 100% 99.8% 100% None 231T>C;390A>G n/a
2 ccsbBroad304_09401 pLX_304 0% 99.8% 100% V5 231T>C;390A>G n/a
3 TRCN0000477828 GATGGCCCCGTTTTGCACTAACTG pLX_317 26.1% 99.8% 100% V5 231T>C;390A>G n/a
Download CSV