Transcript: Human XM_011535496.2

PREDICTED: Homo sapiens ring finger protein 217 (RNF217), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF217 (154214)
Length:
11321
CDS:
116..1585

Additional Resources:

NCBI RefSeq record:
XM_011535496.2
NBCI Gene record:
RNF217 (154214)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034124 GCTCACAATGTAACACTAATT pLKO.1 1203 CDS 100% 13.200 18.480 N RNF217 n/a
2 TRCN0000341592 CCTTGGCATGAAGGTGTTAAC pLKO_005 1046 CDS 100% 10.800 15.120 N Rnf217 n/a
3 TRCN0000034125 GCGGTTGTAATCGTTGAGGAA pLKO.1 1424 CDS 100% 2.640 3.696 N RNF217 n/a
4 TRCN0000341658 CACATCAAACCTCAGTATATT pLKO_005 1276 CDS 100% 15.000 10.500 N Rnf217 n/a
5 TRCN0000034128 CCAGGAATCAAACCCAACATT pLKO.1 1479 CDS 100% 5.625 3.938 N RNF217 n/a
6 TRCN0000034127 CCACACATCAAACCTCAGTAT pLKO.1 1273 CDS 100% 4.950 3.465 N RNF217 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535496.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05079 pDONR223 100% 44.6% 38.7% None (many diffs) n/a
2 ccsbBroad304_05079 pLX_304 0% 44.6% 38.7% V5 (many diffs) n/a
3 TRCN0000476605 TACTTTCGTGGAAGTTTTCAATTG pLX_317 39.8% 44.6% 38.7% V5 (many diffs) n/a
Download CSV