Transcript: Human XM_011535553.3

PREDICTED: Homo sapiens adenylate kinase 9 (AK9), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AK9 (221264)
Length:
6475
CDS:
211..5961

Additional Resources:

NCBI RefSeq record:
XM_011535553.3
NBCI Gene record:
AK9 (221264)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001162330 ACATATACAGTAGAGACCAG pXPR_003 TGG 522 9% 7 0.6175 AK9 AK9 77690
2 BRDN0001147860 AGGCATCTCACGATACCCGA pXPR_003 GGG 2280 40% 21 0.3257 AK9 AK9 77692
3 BRDN0001146911 TACTGCATGGGAGTTAACTG pXPR_003 GGG 2665 46% 24 0.167 AK9 AK9 77689
4 BRDN0001162237 TCACGGGCTTTATCAAAACG pXPR_003 TGG 1287 22% 13 -0.3738 AK9 AK9 77691
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127785 GAAGAGGTAACTGCAGATCAT pLKO.1 1924 CDS 100% 4.950 6.930 N AK9 n/a
2 TRCN0000140490 GCTCTAGTACCTGGTAGCATT pLKO.1 5449 CDS 100% 4.950 6.930 N AK9 n/a
3 TRCN0000140806 GAATTGTACGTGCCTCCCTTA pLKO.1 5290 CDS 100% 4.050 5.670 N AK9 n/a
4 TRCN0000153366 GAAGAGGCATTTATTGCCGAA pLKO.1 835 CDS 100% 2.160 3.024 N AK9 n/a
5 TRCN0000121600 CTCAGAAATATAGACCCAATT pLKO.1 5932 CDS 100% 10.800 7.560 N AK9 n/a
6 TRCN0000140149 GCTACTGTCCAGTGACCTATA pLKO.1 5405 CDS 100% 10.800 7.560 N AK9 n/a
7 TRCN0000128455 GATGAAGAAGGGTACATTCAA pLKO.1 1696 CDS 100% 5.625 3.938 N AK9 n/a
8 TRCN0000139016 CCAGACTTCAGGTGAACTCAA pLKO.1 6091 3UTR 100% 4.950 3.465 N AK9 n/a
9 TRCN0000154027 CCATGACTACCTTACAGCAAA pLKO.1 581 CDS 100% 4.950 3.465 N AK9 n/a
10 TRCN0000139806 CTGCAACTGACTCCTTGGAAT pLKO.1 5195 CDS 100% 4.950 3.465 N AK9 n/a
11 TRCN0000130007 GAAGACTCTTATCCTGATGTT pLKO.1 2665 CDS 100% 4.950 3.465 N AK9 n/a
12 TRCN0000140743 GCAGCCTGAATCTCAAGAGTT pLKO.1 5977 3UTR 100% 4.950 3.465 N AK9 n/a
13 TRCN0000127757 GAAGAGGAGATTGAAGGTGAT pLKO.1 2428 CDS 100% 4.050 2.835 N AK9 n/a
14 TRCN0000150692 GCATGGAAATGTATTCGTGTT pLKO.1 367 CDS 100% 4.050 2.835 N AK9 n/a
15 TRCN0000155314 GCTGAAACCGAATCAGGAGTT pLKO.1 421 CDS 100% 4.050 2.835 N AK9 n/a
16 TRCN0000153728 CAGAAGTCTGTCACTTTGGTT pLKO.1 524 CDS 100% 3.000 2.100 N AK9 n/a
17 TRCN0000143947 CCCAGGAATTATTTGATTGCT pLKO.1 5174 CDS 100% 3.000 2.100 N AK9 n/a
18 TRCN0000128113 CAGTGGAAACAGAAATCCCAA pLKO.1 2579 CDS 100% 2.640 1.848 N AK9 n/a
19 TRCN0000155058 GCACCAAGATACAGATGGCAA pLKO.1 1183 CDS 100% 2.640 1.848 N AK9 n/a
20 TRCN0000154538 GCCAGAGAATTTCTGGGCAAA pLKO.1 674 CDS 100% 0.405 0.284 N AK9 n/a
21 TRCN0000156756 GAGGAAGAGGAAGAGGAAGAT pLKO.1 2941 CDS 100% 4.950 2.475 Y NPM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535553.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09870 pDONR223 100% 21.9% 21.8% None (many diffs) n/a
2 ccsbBroad304_09870 pLX_304 0% 21.9% 21.8% V5 (many diffs) n/a
3 TRCN0000473607 GACAAGATCGTGTAAAGATTAAGA pLX_317 38.5% 21.9% 21.8% V5 (many diffs) n/a
4 ccsbBroadEn_13422 pDONR223 100% 16.1% 16.1% None 1_4818del n/a
5 ccsbBroad304_13422 pLX_304 0% 16.1% 16.1% V5 1_4818del n/a
6 TRCN0000478093 GATAACACCGTCATCCACTACAAT pLX_317 13.1% 16.1% 16.1% V5 1_4818del n/a
Download CSV