Transcript: Human XM_011535626.2

PREDICTED: Homo sapiens forkhead box O3 (FOXO3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FOXO3 (2309)
Length:
6618
CDS:
121..1641

Additional Resources:

NCBI RefSeq record:
XM_011535626.2
NBCI Gene record:
FOXO3 (2309)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235491 CTTGCTCATATCCCATATAAT pLKO_005 6253 3UTR 100% 15.000 10.500 N FOXO3 n/a
2 TRCN0000235489 GAGCTCTAGCTTCCCGTATAC pLKO_005 849 CDS 100% 10.800 6.480 N FOXO3 n/a
3 TRCN0000235487 ATGTGACATGGAGTCCATTAT pLKO_005 1482 CDS 100% 13.200 6.600 Y FOXO3 n/a
4 TRCN0000235490 CTTCCGTTCACGCACCAATTC pLKO_005 543 CDS 100% 10.800 5.400 Y FOXO3 n/a
5 TRCN0000235488 GGACAATAGCAACAAGTATAC pLKO_005 381 CDS 100% 10.800 5.400 Y FOXO3 n/a
6 TRCN0000040102 GTCACTGCATAGTCGATTCAT pLKO.1 261 CDS 100% 5.625 2.813 Y FOXO3 n/a
7 TRCN0000040098 CAGACCCTCAAACTGACACAA pLKO.1 1673 3UTR 100% 4.950 2.475 Y FOXO3 n/a
8 TRCN0000010334 GACAATAGCAACAAGTATACC pLKO.1 382 CDS 100% 4.950 2.475 Y FOXO3 n/a
9 TRCN0000040101 GCAGGCACCATGAATCTGAAT pLKO.1 736 CDS 100% 4.950 2.475 Y FOXO3 n/a
10 TRCN0000010336 CAAACTGACACAAGACCTACA pLKO.1 1681 3UTR 100% 4.050 2.025 Y FOXO3 n/a
11 TRCN0000040100 CTCCTTTAACAGCACGGTGTT pLKO.1 903 CDS 100% 4.050 2.025 Y FOXO3 n/a
12 TRCN0000040099 CCACACAGAATGTTGTTGGTT pLKO.1 1559 CDS 100% 3.000 1.500 Y FOXO3 n/a
13 TRCN0000010335 CATGTTCAATGGGAGCTTGGA pLKO.1 1461 CDS 100% 2.640 1.320 Y FOXO3 n/a
14 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5439 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535626.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00577 pDONR223 100% 73.2% 71% None (many diffs) n/a
2 ccsbBroad304_00577 pLX_304 0% 73.2% 71% V5 (many diffs) n/a
3 TRCN0000470127 TTAATAAGCTTCTTTGCTCCAATA pLX_317 18.3% 73.2% 71% V5 (many diffs) n/a
Download CSV