Transcript: Human XM_011535716.3

PREDICTED: Homo sapiens gamma-aminobutyric acid type A receptor rho2 subunit (GABRR2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GABRR2 (2570)
Length:
4640
CDS:
1901..3001

Additional Resources:

NCBI RefSeq record:
XM_011535716.3
NBCI Gene record:
GABRR2 (2570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415392 CATGTGTGGAATGCTTCATTC pLKO_005 2698 CDS 100% 10.800 7.560 N GABRR2 n/a
2 TRCN0000048675 CATTGACAAATACTCTAGGTT pLKO.1 2923 CDS 100% 3.000 2.100 N GABRR2 n/a
3 TRCN0000048674 CCTATACAGATGAAGATCTAA pLKO.1 2202 CDS 100% 5.625 3.375 N GABRR2 n/a
4 TRCN0000048677 GTCTTCTTTGTTCACTCCAAA pLKO.1 2015 CDS 100% 4.950 2.970 N GABRR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535716.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10835 pDONR223 100% 78.7% 78.7% None 0_1ins297 n/a
2 ccsbBroad304_10835 pLX_304 0% 78.7% 78.7% V5 0_1ins297 n/a
3 TRCN0000472128 CTTCGTCCATTCGGTGCTGCAGGT pLX_317 11.9% 78.7% 78.7% V5 0_1ins297 n/a
Download CSV