Transcript: Human XM_011535773.2

PREDICTED: Homo sapiens discoidin, CUB and LCCL domain containing 1 (DCBLD1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DCBLD1 (285761)
Length:
2034
CDS:
2..1795

Additional Resources:

NCBI RefSeq record:
XM_011535773.2
NBCI Gene record:
DCBLD1 (285761)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365059 TCTAAGTGGAAGACCTATAAA pLKO_005 1199 CDS 100% 15.000 21.000 N DCBLD1 n/a
2 TRCN0000369900 TGGAACGAGCTAGCCATTATT pLKO_005 618 CDS 100% 15.000 21.000 N DCBLD1 n/a
3 TRCN0000369828 CAGCGACCATCCAGATTTAAT pLKO_005 589 CDS 100% 15.000 12.000 N DCBLD1 n/a
4 TRCN0000365058 GACTGTTGGAAGCAGATTAAA pLKO_005 1637 CDS 100% 15.000 10.500 N DCBLD1 n/a
5 TRCN0000365015 GAATATGGTAGATGGATATAG pLKO_005 703 CDS 100% 13.200 9.240 N DCBLD1 n/a
6 TRCN0000107021 GCAGGAATAATTGCTGATGAA pLKO.1 758 CDS 100% 4.950 3.465 N DCBLD1 n/a
7 TRCN0000107024 CCAATCACACTGTTTGCGAAA pLKO.1 330 CDS 100% 4.050 2.835 N DCBLD1 n/a
8 TRCN0000107022 CGGAAGAAACATCCACAGGAA pLKO.1 1482 CDS 100% 2.640 1.848 N DCBLD1 n/a
9 TRCN0000107023 GCTGAGTTTACCATCAGCTAT pLKO.1 1682 CDS 100% 0.495 0.347 N DCBLD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535773.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14468 pDONR223 99.4% 90% 89.6% None (many diffs) n/a
2 ccsbBroad304_14468 pLX_304 0% 90% 89.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000467468 GTCCAGGTGACCATGTATAAGGGC pLX_317 26.3% 90% 89.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV