Transcript: Human XM_011535782.1

PREDICTED: Homo sapiens glutamate metabotropic receptor 1 (GRM1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GRM1 (2911)
Length:
5966
CDS:
471..4055

Additional Resources:

NCBI RefSeq record:
XM_011535782.1
NBCI Gene record:
GRM1 (2911)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011535782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000357372 CGACGACAGCGAGAGGTTTAA pLKO_005 3761 CDS 100% 13.200 18.480 N GRM1 n/a
2 TRCN0000009008 CCCAAGTATCAAGGAAGTCTA pLKO.1 2678 CDS 100% 4.950 3.960 N GRM1 n/a
3 TRCN0000367785 AGCAACATCGAATCCATTATA pLKO_005 2235 CDS 100% 15.000 10.500 N GRM1 n/a
4 TRCN0000357373 CGCTCCTGGAAGGTATGATAT pLKO_005 1892 CDS 100% 13.200 9.240 N GRM1 n/a
5 TRCN0000009007 GCCTGCAAAGAGAATGAATAT pLKO.1 2115 CDS 100% 13.200 9.240 N GRM1 n/a
6 TRCN0000009010 CCTCAACATCTTCCGAAGAAA pLKO.1 3086 CDS 100% 5.625 3.938 N GRM1 n/a
7 TRCN0000009009 GCCATGCTTGACATAGTCAAA pLKO.1 1110 CDS 100% 4.950 3.465 N GRM1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011535782.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488800 CTAACTCGTCTTCGGTTCTGTGCC pLX_317 7.7% 99.9% 100% V5 (not translated due to prior stop codon) 3168T>G n/a
2 TRCN0000489197 GGTACACCCGTGTGGTACCCGATA pLX_317 9.3% 99.9% 99.9% V5 3168T>G;3582_3583insG n/a
Download CSV