Transcript: Human XM_011536244.3

PREDICTED: Homo sapiens microtubule associated protein 7 (MAP7), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP7 (9053)
Length:
6651
CDS:
3158..5386

Additional Resources:

NCBI RefSeq record:
XM_011536244.3
NBCI Gene record:
MAP7 (9053)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304055 ATGGGAGAGCAGCGTTGTTAA pLKO_005 3772 CDS 100% 13.200 18.480 N MAP7 n/a
2 TRCN0000108435 GCCCTCTTACATAATGTATTT pLKO.1 6048 3UTR 100% 13.200 18.480 N MAP7 n/a
3 TRCN0000108438 CGACTTGAGGAGATTATGAAA pLKO.1 4940 CDS 100% 5.625 7.875 N MAP7 n/a
4 TRCN0000300363 CGACTTGAGGAGATTATGAAA pLKO_005 4940 CDS 100% 5.625 7.875 N MAP7 n/a
5 TRCN0000303999 ACTTACCCATTGGATCTAAAC pLKO_005 5226 CDS 100% 10.800 8.640 N MAP7 n/a
6 TRCN0000108436 GCACCTTTAGTGAAGGTAGAA pLKO.1 4340 CDS 100% 0.495 0.396 N MAP7 n/a
7 TRCN0000331347 TAGAGTTCTTGACCATCATTT pLKO_005 5487 3UTR 100% 13.200 9.240 N MAP7 n/a
8 TRCN0000108439 AGCCCAGAAATTCCTTTGAAT pLKO.1 5276 CDS 100% 5.625 3.938 N MAP7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536244.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07349 pDONR223 100% 90.3% 88.4% None (many diffs) n/a
2 ccsbBroad304_07349 pLX_304 0% 90.3% 88.4% V5 (many diffs) n/a
3 TRCN0000466270 TGATTATCATCGAGACCCGACAGC pLX_317 13.8% 90.3% 88.4% V5 (many diffs) n/a
Download CSV