Transcript: Human XM_011536378.3

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase kinase 5 (MAP4K5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP4K5 (11183)
Length:
4133
CDS:
267..2606

Additional Resources:

NCBI RefSeq record:
XM_011536378.3
NBCI Gene record:
MAP4K5 (11183)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195575 CAGGATTAGCTGCCCATATTC pLKO.1 1834 CDS 100% 13.200 18.480 N MAP4K5 n/a
2 TRCN0000002189 GCTCTACTCTCACAATCTTAT pLKO.1 1787 CDS 100% 13.200 18.480 N MAP4K5 n/a
3 TRCN0000195599 CCTATGGTCTGTGTAGCTATT pLKO.1 2121 CDS 100% 10.800 15.120 N MAP4K5 n/a
4 TRCN0000197209 GTAACATCGTTGCCTACTTTG pLKO.1 289 CDS 100% 10.800 15.120 N MAP4K5 n/a
5 TRCN0000002187 GCCACCTATGTTTGATCTCCA pLKO.1 710 CDS 100% 2.640 3.696 N MAP4K5 n/a
6 TRCN0000197246 GACAGACCATGGCGATGTAAA pLKO.1 509 CDS 100% 13.200 10.560 N MAP4K5 n/a
7 TRCN0000197245 GCCACTGTGTGGTGGTTATAT pLKO.1 2790 3UTR 100% 15.000 10.500 N MAP4K5 n/a
8 TRCN0000362467 TGGAACTGAAGATGGTATTTA pLKO_005 1646 CDS 100% 15.000 10.500 N Map4k5 n/a
9 TRCN0000002190 CAAAGTGAACAATCCAGATAA pLKO.1 941 CDS 100% 13.200 9.240 N MAP4K5 n/a
10 TRCN0000194753 CCTGATGGGATAGTATCAATA pLKO.1 3669 3UTR 100% 13.200 9.240 N MAP4K5 n/a
11 TRCN0000194698 CTTGCCTATTTGCATACTAAA pLKO.1 447 CDS 100% 13.200 9.240 N MAP4K5 n/a
12 TRCN0000197179 GCTGGAAACAGCTAGTCTATC pLKO.1 2765 3UTR 100% 10.800 7.560 N MAP4K5 n/a
13 TRCN0000197122 GCTGTGTCTACCATGTGTATG pLKO.1 3388 3UTR 100% 10.800 7.560 N MAP4K5 n/a
14 TRCN0000362469 GTGGTGGTTATATCAAGTTTG pLKO_005 2798 3UTR 100% 10.800 7.560 N Map4k5 n/a
15 TRCN0000002188 CAACAAAGATTCCTGATACAA pLKO.1 1903 CDS 100% 5.625 3.938 N MAP4K5 n/a
16 TRCN0000002191 CTCTACATCTTGGCTGGACAT pLKO.1 2571 CDS 100% 4.050 2.835 N MAP4K5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536378.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14987 pDONR223 0% 92% 92% None 0_1ins201 n/a
2 ccsbBroad304_14987 pLX_304 0% 92% 92% V5 0_1ins201 n/a
3 TRCN0000481402 CAGCAATATACCGATGTCGAACGT pLX_317 16.1% 92% 92% V5 0_1ins201 n/a
4 TRCN0000489738 ACGTTCGTAGTTTCTTTTAGTTTC pLX_317 15.9% 92% 92% V5 (not translated due to prior stop codon) 0_1ins201 n/a
Download CSV