Transcript: Human XM_011536398.3

PREDICTED: Homo sapiens tudor domain containing 9 (TDRD9), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TDRD9 (122402)
Length:
4698
CDS:
88..4122

Additional Resources:

NCBI RefSeq record:
XM_011536398.3
NBCI Gene record:
TDRD9 (122402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358672 AGGATGTCGTCGAGGTTAATA pLKO_005 3815 CDS 100% 15.000 21.000 N TDRD9 n/a
2 TRCN0000358610 ATCGCCAGGTGGATCAGTAAA pLKO_005 556 CDS 100% 13.200 18.480 N TDRD9 n/a
3 TRCN0000358609 GCGCACCATCCTTCTACTAAA pLKO_005 1662 CDS 100% 13.200 18.480 N TDRD9 n/a
4 TRCN0000358671 TCGCACCGGTGATAGAGTTAA pLKO_005 3668 CDS 100% 13.200 18.480 N TDRD9 n/a
5 TRCN0000050693 CCGGTGATAACTAAGGATATA pLKO.1 1009 CDS 100% 13.200 9.240 N TDRD9 n/a
6 TRCN0000050697 GCAGGTGCTTTCTATCCAAAT pLKO.1 2206 CDS 100% 10.800 7.560 N TDRD9 n/a
7 TRCN0000050694 CCCTATGGATTTCTTTACTAT pLKO.1 2320 CDS 100% 5.625 3.938 N TDRD9 n/a
8 TRCN0000050695 CCCTGTCAATTTCTTGAACTT pLKO.1 2965 CDS 100% 4.950 3.465 N TDRD9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536398.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13087 pDONR223 100% 65.2% 64.9% None (many diffs) n/a
2 ccsbBroad304_13087 pLX_304 0% 65.2% 64.9% V5 (many diffs) n/a
3 TRCN0000472461 TCTCCCTTACTTGTGAGGATAAAA pLX_317 15.1% 65.2% 64.9% V5 (many diffs) n/a
Download CSV