Transcript: Human XM_011536400.2

PREDICTED: Homo sapiens tudor domain containing 9 (TDRD9), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TDRD9 (122402)
Length:
4631
CDS:
168..4055

Additional Resources:

NCBI RefSeq record:
XM_011536400.2
NBCI Gene record:
TDRD9 (122402)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536400.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358672 AGGATGTCGTCGAGGTTAATA pLKO_005 3748 CDS 100% 15.000 21.000 N TDRD9 n/a
2 TRCN0000358610 ATCGCCAGGTGGATCAGTAAA pLKO_005 750 CDS 100% 13.200 18.480 N TDRD9 n/a
3 TRCN0000358609 GCGCACCATCCTTCTACTAAA pLKO_005 1595 CDS 100% 13.200 18.480 N TDRD9 n/a
4 TRCN0000358671 TCGCACCGGTGATAGAGTTAA pLKO_005 3601 CDS 100% 13.200 18.480 N TDRD9 n/a
5 TRCN0000050693 CCGGTGATAACTAAGGATATA pLKO.1 1203 CDS 100% 13.200 9.240 N TDRD9 n/a
6 TRCN0000050697 GCAGGTGCTTTCTATCCAAAT pLKO.1 2139 CDS 100% 10.800 7.560 N TDRD9 n/a
7 TRCN0000050694 CCCTATGGATTTCTTTACTAT pLKO.1 2253 CDS 100% 5.625 3.938 N TDRD9 n/a
8 TRCN0000050695 CCCTGTCAATTTCTTGAACTT pLKO.1 2898 CDS 100% 4.950 3.465 N TDRD9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536400.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13087 pDONR223 100% 57.1% 56.8% None (many diffs) n/a
2 ccsbBroad304_13087 pLX_304 0% 57.1% 56.8% V5 (many diffs) n/a
3 TRCN0000472461 TCTCCCTTACTTGTGAGGATAAAA pLX_317 15.1% 57.1% 56.8% V5 (many diffs) n/a
Download CSV