Transcript: Human XM_011536426.1

PREDICTED: Homo sapiens suppressor of cytokine signaling 4 (SOCS4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SOCS4 (122809)
Length:
6982
CDS:
535..1857

Additional Resources:

NCBI RefSeq record:
XM_011536426.1
NBCI Gene record:
SOCS4 (122809)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000057070 GCTAGAATTGAACAGTGGAAT pLKO.1 1531 CDS 100% 4.950 3.960 N SOCS4 n/a
2 TRCN0000057071 CCACCGACAATGCTTTGTGTA pLKO.1 1130 CDS 100% 4.950 3.465 N SOCS4 n/a
3 TRCN0000057069 CCCTTCCAATTCCTTCTTCTA pLKO.1 1757 CDS 100% 4.950 3.465 N SOCS4 n/a
4 TRCN0000057072 GCAGTTGGAAACACCTCCTAA pLKO.1 1302 CDS 100% 4.950 3.465 N SOCS4 n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5670 3UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5670 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536426.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04767 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04767 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000480424 TCTGGAGATGGACTTTCATACAAA pLX_317 34.8% 100% 100% V5 n/a
Download CSV