Transcript: Human XM_011536448.2

PREDICTED: Homo sapiens solute carrier family 25 member 29 (SLC25A29), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC25A29 (123096)
Length:
3101
CDS:
1216..1929

Additional Resources:

NCBI RefSeq record:
XM_011536448.2
NBCI Gene record:
SLC25A29 (123096)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245277 CTGAGGCCATTGCACCGTTAT pLKO_005 2200 3UTR 100% 10.800 15.120 N SLC25A29 n/a
2 TRCN0000044777 GCGGTACGTCAGGCATCGTGT pLKO.1 1604 CDS 100% 0.000 0.000 N SLC25A29 n/a
3 TRCN0000245274 GGACGTTGCACTGCTTCAAGT pLKO_005 1139 5UTR 100% 4.950 3.960 N SLC25A29 n/a
4 TRCN0000044774 GCGCACCTACAAGGGCTCGCT pLKO.1 1401 CDS 100% 0.000 0.000 N SLC25A29 n/a
5 TRCN0000245275 GCGTCTACTTCCTCACCTATG pLKO_005 1514 CDS 100% 6.000 4.200 N SLC25A29 n/a
6 TRCN0000245276 TGTCCTGGCTCTCTACCTATC pLKO_005 1622 CDS 100% 6.000 4.200 N SLC25A29 n/a
7 TRCN0000044776 CTGGCTCTCTACCTATCCTGT pLKO.1 1626 CDS 100% 2.640 1.848 N SLC25A29 n/a
8 TRCN0000044775 CTCAACCAGTTCCTGGCAGGT pLKO.1 1294 CDS 100% 0.720 0.504 N SLC25A29 n/a
9 TRCN0000044773 GCTGCGTGAGACGCCCAGCTT pLKO.1 1491 CDS 100% 0.000 0.000 N SLC25A29 n/a
10 TRCN0000245273 CCGTTTGACACGGTCAAGGTA pLKO_005 273 5UTR 100% 3.000 4.200 N SLC25A29 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536448.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13094 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_13094 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476991 TGTCGTGCTATGACCAACGATATA pLX_317 21.3% 100% 100% V5 n/a
Download CSV