Transcript: Human XM_011536471.3

PREDICTED: Homo sapiens armadillo like helical domain containing 4 (ARMH4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARMH4 (145407)
Length:
2196
CDS:
204..2108

Additional Resources:

NCBI RefSeq record:
XM_011536471.3
NBCI Gene record:
ARMH4 (145407)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536471.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121752 CCATCTATTACTCGTGTTAAT pLKO.1 1974 CDS 100% 13.200 18.480 N ARMH4 n/a
2 TRCN0000144724 GAAGAACTGTTGTTCCATCTA pLKO.1 1960 CDS 100% 4.950 3.465 N ARMH4 n/a
3 TRCN0000140587 GCATCCTCTGAGAGAAGAACT pLKO.1 1947 CDS 100% 4.950 3.465 N ARMH4 n/a
4 TRCN0000139540 CGTGTTAATACAGCTGCCTCA pLKO.1 1986 CDS 100% 2.160 1.512 N ARMH4 n/a
5 TRCN0000144995 GAAGAGGATGAAGAAGATGAA pLKO.1 2171 3UTR 100% 4.950 2.970 N ARMH4 n/a
6 TRCN0000143538 GATGAGGATGAAGAGGATGAA pLKO.1 2162 3UTR 100% 4.950 2.970 N ARMH4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536471.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09619 pDONR223 100% 80.9% 78.2% None (many diffs) n/a
2 ccsbBroad304_09619 pLX_304 0% 80.9% 78.2% V5 (many diffs) n/a
3 TRCN0000480285 TGTAGCTGACGCTCAGAAAATGGG pLX_317 16.3% 80.9% 78.2% V5 (many diffs) n/a
Download CSV