Transcript: Human XM_011536472.1

PREDICTED: Homo sapiens abhydrolase domain containing 12B (ABHD12B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABHD12B (145447)
Length:
907
CDS:
86..886

Additional Resources:

NCBI RefSeq record:
XM_011536472.1
NBCI Gene record:
ABHD12B (145447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536472.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075299 CGTGATGGGAACCCAATTATT pLKO.1 491 CDS 100% 15.000 10.500 N ABHD12B n/a
2 TRCN0000414904 GGTACAGGAGTTGCAACAAAT pLKO_005 740 CDS 100% 13.200 9.240 N ABHD12B n/a
3 TRCN0000424843 GTGGGTTGCAAGTATCAATTA pLKO_005 832 CDS 100% 13.200 9.240 N ABHD12B n/a
4 TRCN0000075300 CCCAGTTGATGCTATTGTCTT pLKO.1 790 CDS 100% 4.950 3.465 N ABHD12B n/a
5 TRCN0000075301 GCCCAGTTGATGCTATTGTCT pLKO.1 789 CDS 100% 3.000 1.800 N ABHD12B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536472.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09620 pDONR223 100% 51.7% 50.5% None (many diffs) n/a
2 ccsbBroad304_09620 pLX_304 0% 51.7% 50.5% V5 (many diffs) n/a
3 TRCN0000475071 CAGACGAAAGCTCACAATCTTGGC pLX_317 66.7% 51.7% 50.5% V5 (many diffs) n/a
Download CSV