Transcript: Human XM_011536605.2

PREDICTED: Homo sapiens dicer 1, ribonuclease III (DICER1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DICER1 (23405)
Length:
14797
CDS:
6405..10694

Additional Resources:

NCBI RefSeq record:
XM_011536605.2
NBCI Gene record:
DICER1 (23405)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000051262 GCTGGCTGTAAAGTACGACTA pLKO.1 10166 CDS 100% 4.050 5.670 N DICER1 n/a
2 TRCN0000290488 GCTGGCTGTAAAGTACGACTA pLKO_005 10166 CDS 100% 4.050 5.670 N DICER1 n/a
3 TRCN0000051261 GCCAAGGAAATCAGCTAAATT pLKO.1 8515 CDS 100% 15.000 10.500 N DICER1 n/a
4 TRCN0000290486 GCCAAGGAAATCAGCTAAATT pLKO_005 8515 CDS 100% 15.000 10.500 N DICER1 n/a
5 TRCN0000051260 CCACACATCTTCAAGACTTAA pLKO.1 7898 CDS 100% 13.200 9.240 N DICER1 n/a
6 TRCN0000290426 CCACACATCTTCAAGACTTAA pLKO_005 7898 CDS 100% 13.200 9.240 N DICER1 n/a
7 TRCN0000051259 CGGGAGAATTTCAACAGCCAA pLKO.1 9744 CDS 100% 2.640 1.848 N DICER1 n/a
8 TRCN0000290490 CGGGAGAATTTCAACAGCCAA pLKO_005 9744 CDS 100% 2.640 1.848 N DICER1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536605.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02759 pDONR223 100% 74.3% 74.3% None 0_1ins1479 n/a
2 ccsbBroad304_02759 pLX_304 0% 74.3% 74.3% V5 0_1ins1479 n/a
3 TRCN0000491528 CTTAGGGCAATCCTTAGGTGAATG pLX_317 4.7% 74.3% 74.3% V5 0_1ins1479 n/a
Download CSV