Transcript: Human XM_011536655.3

PREDICTED: Homo sapiens distal membrane arm assembly complex 2 like (DMAC2L), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DMAC2L (27109)
Length:
2143
CDS:
502..999

Additional Resources:

NCBI RefSeq record:
XM_011536655.3
NBCI Gene record:
DMAC2L (27109)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011536655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038418 GCAGTTGTGTGGCGTAAAGAA pLKO.1 660 CDS 100% 5.625 7.875 N DMAC2L n/a
2 TRCN0000038417 CGACTCTTGTATCATGAGCAT pLKO.1 912 CDS 100% 2.640 3.696 N DMAC2L n/a
3 TRCN0000230133 TGCAGTTGACTCACGATTATA pLKO_005 1009 3UTR 100% 15.000 10.500 N DMAC2L n/a
4 TRCN0000038415 GCTGGTTGAATGCAGTGTTTA pLKO.1 716 CDS 100% 13.200 9.240 N DMAC2L n/a
5 TRCN0000230132 TGTTTAATAAGGTGGATTATG pLKO_005 731 CDS 100% 13.200 9.240 N DMAC2L n/a
6 TRCN0000230131 CCAGCAGTTGTGTGGCGTAAA pLKO_005 657 CDS 100% 10.800 7.560 N DMAC2L n/a
7 TRCN0000219104 GATGATTTGCAGTGACCATTT pLKO_005 985 CDS 100% 10.800 7.560 N DMAC2L n/a
8 TRCN0000076122 GTCATGTGACTCCAGATACTT pLKO.1 690 CDS 100% 5.625 3.938 N Atp5s n/a
9 TRCN0000038416 CCCTCTGGACAAATACAAGAT pLKO.1 873 CDS 100% 4.950 3.465 N DMAC2L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011536655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08055 pDONR223 100% 72.8% 65.2% None (many diffs) n/a
2 ccsbBroad304_08055 pLX_304 0% 72.8% 65.2% V5 (many diffs) n/a
3 TRCN0000472717 GTCATATTACGAGGTGACAAGGAG pLX_317 90.7% 72.8% 65.2% V5 (many diffs) n/a
Download CSV