Transcript: Human XM_011537064.1

PREDICTED: Homo sapiens spalt like transcription factor 2 (SALL2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SALL2 (6297)
Length:
4281
CDS:
222..3353

Additional Resources:

NCBI RefSeq record:
XM_011537064.1
NBCI Gene record:
SALL2 (6297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234699 GGGTAATCTGCGTGCACATTT pLKO_005 2234 CDS 100% 13.200 18.480 N SALL2 n/a
2 TRCN0000234697 TGCCAAGTGCTGCGCACAATT pLKO_005 329 CDS 100% 13.200 18.480 N SALL2 n/a
3 TRCN0000234698 ACTCGCATGCAACTAAGTAAG pLKO_005 1857 CDS 100% 10.800 15.120 N SALL2 n/a
4 TRCN0000238794 CCGCTTCTGTGCCAAAGTATT pLKO_005 1346 CDS 100% 13.200 10.560 N SALL2 n/a
5 TRCN0000153893 CAATGTCTGTGGAAACCGTTT pLKO.1 1430 CDS 100% 4.050 3.240 N SALL2 n/a
6 TRCN0000152761 GCAGTGGAACCCAAGAATAAA pLKO.1 1767 CDS 100% 15.000 10.500 N SALL2 n/a
7 TRCN0000153534 CCCAGGAGATATTTGGGAAAT pLKO.1 3608 3UTR 100% 10.800 7.560 N SALL2 n/a
8 TRCN0000155756 CAGTGGCTTGCCTTATGGTAT pLKO.1 1562 CDS 100% 4.950 3.465 N SALL2 n/a
9 TRCN0000151157 GAGATGGACAGTAATGAGAAA pLKO.1 2691 CDS 100% 4.950 3.465 N SALL2 n/a
10 TRCN0000153151 GCAATATCAGTGAGAGGTGAT pLKO.1 2604 CDS 100% 4.050 2.835 N SALL2 n/a
11 TRCN0000154389 CAGATGCAGATGACTGAGCAA pLKO.1 807 CDS 100% 2.640 1.848 N SALL2 n/a
12 TRCN0000155641 CAGTTAATCTCGGACTGCGAA pLKO.1 252 CDS 100% 2.640 1.848 N SALL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537064.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11117 pDONR223 100% 16.2% 11.5% None (many diffs) n/a
2 ccsbBroad304_11117 pLX_304 0% 16.2% 11.5% V5 (many diffs) n/a
3 TRCN0000492012 TGATACCACTGCTATCCAACTCAA pLX_317 59.1% 16.2% 11.5% V5 (many diffs) n/a
Download CSV