Transcript: Human XM_011537112.2

PREDICTED: Homo sapiens TNF alpha induced protein 2 (TNFAIP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFAIP2 (7127)
Length:
4491
CDS:
905..3055

Additional Resources:

NCBI RefSeq record:
XM_011537112.2
NBCI Gene record:
TNFAIP2 (7127)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000133786 CGCCTTTAATGAATTTCTGGA pLKO.1 2113 CDS 100% 2.640 3.696 N TNFAIP2 n/a
2 TRCN0000353652 CGCCTTTAATGAATTTCTGGA pLKO_005 2113 CDS 100% 2.640 3.696 N TNFAIP2 n/a
3 TRCN0000330220 AGGCAAGCAGCTGACGAATTA pLKO_005 2137 CDS 100% 13.200 10.560 N TNFAIP2 n/a
4 TRCN0000330290 AGATTGAGGTGGCCACTTATG pLKO_005 2685 CDS 100% 10.800 7.560 N TNFAIP2 n/a
5 TRCN0000135229 CCACAAACTTCGTGGATCAAA pLKO.1 3314 3UTR 100% 5.625 3.938 N TNFAIP2 n/a
6 TRCN0000330288 CCACAAACTTCGTGGATCAAA pLKO_005 3314 3UTR 100% 5.625 3.938 N TNFAIP2 n/a
7 TRCN0000135170 CTTCACCAAAGGGAAGAAGAA pLKO.1 1042 CDS 100% 4.950 3.465 N TNFAIP2 n/a
8 TRCN0000138492 CGTCTTCACCAAAGGGAAGAA pLKO.1 1039 CDS 100% 0.495 0.347 N TNFAIP2 n/a
9 TRCN0000353651 CGTCTTCACCAAAGGGAAGAA pLKO_005 1039 CDS 100% 0.495 0.347 N TNFAIP2 n/a
10 TRCN0000134370 GAAGAAGAAGAAGGAGAAGAA pLKO.1 985 CDS 100% 4.950 2.475 Y TNFAIP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537112.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11196 pDONR223 100% 60.1% 59.7% None (many diffs) n/a
2 ccsbBroad304_11196 pLX_304 0% 60.1% 59.7% V5 (many diffs) n/a
3 TRCN0000466690 ACACCGGTCTGCTCCCGATCGGGC pLX_317 16.8% 60.1% 59.7% V5 (many diffs) n/a
Download CSV