Transcript: Human XM_011537189.3

PREDICTED: Homo sapiens DDHD domain containing 1 (DDHD1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DDHD1 (80821)
Length:
12980
CDS:
226..2967

Additional Resources:

NCBI RefSeq record:
XM_011537189.3
NBCI Gene record:
DDHD1 (80821)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431564 TTGTAACCGGTTACTAAATAT pLKO_005 2298 CDS 100% 15.000 21.000 N DDHD1 n/a
2 TRCN0000427267 AGTCTCAATAGTATCACATTC pLKO_005 1938 CDS 100% 10.800 15.120 N DDHD1 n/a
3 TRCN0000051023 GCCGACACTATGGAGAATCTA pLKO.1 2543 CDS 100% 5.625 7.875 N DDHD1 n/a
4 TRCN0000432617 AGTGATGCAACAACATCTAAA pLKO_005 1429 CDS 100% 13.200 10.560 N DDHD1 n/a
5 TRCN0000414560 CACGTCGCATACTGCCTATTG pLKO_005 2856 CDS 100% 10.800 8.640 N DDHD1 n/a
6 TRCN0000051025 GCCATCACAGACTACCCATAT pLKO.1 1551 CDS 100% 10.800 8.640 N DDHD1 n/a
7 TRCN0000434626 AGCAGTGCAATGGACATAATG pLKO_005 1801 CDS 100% 13.200 9.240 N DDHD1 n/a
8 TRCN0000418646 AGTTCTGAAGAAGTCATTTAC pLKO_005 3133 3UTR 100% 13.200 9.240 N DDHD1 n/a
9 TRCN0000421575 TTGGGATGTGTAATTACTTAT pLKO_005 1960 CDS 100% 13.200 9.240 N DDHD1 n/a
10 TRCN0000422466 CCAGATCCACTGGTACAATAC pLKO_005 2394 CDS 100% 10.800 7.560 N DDHD1 n/a
11 TRCN0000051024 CCTGACAAAGTACGAGGTTTA pLKO.1 1765 CDS 100% 10.800 7.560 N DDHD1 n/a
12 TRCN0000051027 CCAGGAAATACTGGAAGTCAA pLKO.1 2254 CDS 100% 4.950 3.465 N DDHD1 n/a
13 TRCN0000051026 CGGCTGAAGGAAATAGAAGAA pLKO.1 2113 CDS 100% 4.950 3.465 N DDHD1 n/a
14 TRCN0000313463 AGCAAGAGCTGAATCGATTAT pLKO_005 1868 CDS 100% 13.200 9.240 N Ddhd1 n/a
15 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6028 3UTR 100% 13.200 6.600 Y LIAS n/a
16 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6314 3UTR 100% 4.950 2.475 Y KAAG1 n/a
17 TRCN0000074123 CGCCTGTAATCCCAACACTTT pLKO.1 4231 3UTR 100% 4.950 2.475 Y GJD4 n/a
18 TRCN0000166650 CGCCTGTAATCCCAACACTTT pLKO.1 4231 3UTR 100% 4.950 2.475 Y C9orf85 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537189.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09052 pDONR223 100% 95.4% 95.3% None 1012_1134del;2147A>G n/a
2 ccsbBroad304_09052 pLX_304 0% 95.4% 95.3% V5 1012_1134del;2147A>G n/a
3 TRCN0000477591 ATTCCCAATCATCACCCGATGCTC pLX_317 18.8% 95.4% 95.3% V5 1012_1134del;2147A>G n/a
Download CSV