Transcript: Human XM_011537553.2

PREDICTED: Homo sapiens PPARG coactivator 1 beta (PPARGC1B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPARGC1B (133522)
Length:
3513
CDS:
42..3236

Additional Resources:

NCBI RefSeq record:
XM_011537553.2
NBCI Gene record:
PPARGC1B (133522)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000008600 GCATAGTCTAGGCAAAGAAAT pLKO.1 1916 CDS 100% 13.200 18.480 N PPARGC1B n/a
2 TRCN0000429958 AGCAACTCTATGCTGACTTTC pLKO_005 139 CDS 100% 10.800 7.560 N PPARGC1B n/a
3 TRCN0000008599 CCAGAGAACTCAGAGACTGAA pLKO.1 234 CDS 100% 4.950 3.465 N PPARGC1B n/a
4 TRCN0000008598 CCTGAGTATGACACTGTCTTT pLKO.1 2397 CDS 100% 4.950 3.465 N PPARGC1B n/a
5 TRCN0000008601 CCCAGATACACTGACTACGAT pLKO.1 2994 CDS 100% 3.000 2.100 N PPARGC1B n/a
6 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 1342 CDS 100% 4.050 2.025 Y Myt1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537553.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09548 pDONR223 100% 95% .4% None (many diffs) n/a
2 ccsbBroad304_09548 pLX_304 0% 95% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000477546 TCATACCGTCTACGAGTTAGATCC pLX_317 14.3% 95% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV