Transcript: Human XM_011537576.1

PREDICTED: Homo sapiens serine/threonine kinase 32A (STK32A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STK32A (202374)
Length:
4659
CDS:
23..1240

Additional Resources:

NCBI RefSeq record:
XM_011537576.1
NBCI Gene record:
STK32A (202374)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537576.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007130 GCAACAGAACGTCCACTTCAA pLKO.1 352 CDS 100% 4.950 6.930 N STK32A n/a
2 TRCN0000007127 GCACCCTTTCCTGGTTAATTT pLKO.1 253 CDS 100% 15.000 10.500 N STK32A n/a
3 TRCN0000195096 CGCAATGAAGTACATGAATAA pLKO.1 163 CDS 100% 13.200 9.240 N STK32A n/a
4 TRCN0000007128 GAGCGCAATGAAGTGAGAAAT pLKO.1 197 CDS 100% 13.200 9.240 N STK32A n/a
5 TRCN0000022822 GCGCATCATTCACAGGGATAT pLKO.1 436 CDS 100% 10.800 7.560 N Stk32a n/a
6 TRCN0000007131 TCCTGGTTAATTTGTGGTATT pLKO.1 261 CDS 100% 10.800 7.560 N STK32A n/a
7 TRCN0000007129 GAAGAATGATACCAAGAAGAT pLKO.1 139 CDS 100% 4.950 3.465 N STK32A n/a
8 TRCN0000199618 GCTCTTCATCTGTGAGCTGGT pLKO.1 388 CDS 100% 2.160 1.512 N STK32A n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 2200 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000165774 CCTCCTAAGTAGCTGGGATTA pLKO.1 2061 3UTR 100% 10.800 5.400 Y SNX29P1 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 2200 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537576.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09823 pDONR223 100% 37.6% 34.5% None (many diffs) n/a
2 ccsbBroad304_09823 pLX_304 0% 37.6% 34.5% V5 (many diffs) n/a
3 TRCN0000466743 TTGCGTGTGATGTTCCCACTTATC pLX_317 58.8% 37.6% 34.5% V5 (many diffs) n/a
4 ccsbBroadEn_15284 pDONR223 0% 37.6% 34.5% None (many diffs) n/a
5 ccsbBroad304_15284 pLX_304 0% 37.6% 34.5% V5 (many diffs) n/a
6 TRCN0000489951 TCAACAACCCATGATATTGCCACC pLX_317 95% 37.6% 34.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV