Transcript: Human XM_011537670.2

PREDICTED: Homo sapiens neuromedin U receptor 2 (NMUR2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NMUR2 (56923)
Length:
1169
CDS:
161..1126

Additional Resources:

NCBI RefSeq record:
XM_011537670.2
NBCI Gene record:
NMUR2 (56923)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000009200 GCGCAACTACCCTTTCTTGTT pLKO.1 481 CDS 100% 4.950 3.960 N NMUR2 n/a
2 TRCN0000009199 GCCCATGTGGATCTACAATTT pLKO.1 784 CDS 100% 13.200 9.240 N NMUR2 n/a
3 TRCN0000357657 CTCATGGCACTCAGACTAAAG pLKO_005 872 CDS 100% 10.800 7.560 N NMUR2 n/a
4 TRCN0000011775 GACCGACTCTTCTTCAGCTTT pLKO.1 1019 CDS 100% 4.950 3.465 N NMUR2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537670.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08664 pDONR223 100% 75.6% 75.6% None (many diffs) n/a
2 ccsbBroad304_08664 pLX_304 0% 75.6% 75.6% V5 (many diffs) n/a
3 TRCN0000480467 CGCCCCTCCAATCAGTTCATAAAG pLX_317 30.7% 75.6% 75.6% V5 (many diffs) n/a
4 ccsbBroadEn_08663 pDONR223 100% 75.5% 75.4% None (many diffs) n/a
5 ccsbBroad304_08663 pLX_304 0% 75.5% 75.4% V5 (many diffs) n/a
6 TRCN0000466595 TGCCGTTTTCTGAGATCCTTGACC pLX_317 24% 75.5% 75.4% V5 (many diffs) n/a
7 TRCN0000488352 CGAGTGTACAGGTAAAGCGCTCCA pLX_317 23.7% 75.5% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV