Transcript: Human XM_011537886.2

PREDICTED: Homo sapiens coiled-coil domain containing 38 (CCDC38), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC38 (120935)
Length:
2139
CDS:
546..2117

Additional Resources:

NCBI RefSeq record:
XM_011537886.2
NBCI Gene record:
CCDC38 (120935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537886.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121843 GAACCGTAACATGAAAGTCTA pLKO.1 575 CDS 100% 4.950 6.930 N CCDC38 n/a
2 TRCN0000140922 CAATGAGGGAACGGCAACTAA pLKO.1 847 CDS 100% 5.625 4.500 N CCDC38 n/a
3 TRCN0000144969 GCAATTAAAGTCCAAGCTCTT pLKO.1 1652 CDS 100% 4.050 3.240 N CCDC38 n/a
4 TRCN0000140281 GAACTGTGTGACCTCATCGAA pLKO.1 1827 CDS 100% 3.000 2.400 N CCDC38 n/a
5 TRCN0000142842 CTGCTCCGATTCCTAGATTAA pLKO.1 703 CDS 100% 13.200 9.240 N CCDC38 n/a
6 TRCN0000145511 GAGAGGATGAAACAGAAAGAA pLKO.1 1878 CDS 100% 5.625 3.938 N CCDC38 n/a
7 TRCN0000121691 GAGCAGAATCTTACTTTGTTT pLKO.1 1476 CDS 100% 5.625 3.938 N CCDC38 n/a
8 TRCN0000144533 CAGAGATCTCTTTCTTGTCAA pLKO.1 515 5UTR 100% 4.950 3.465 N CCDC38 n/a
9 TRCN0000121844 GAGTATGCTTTGTCAACCAAA pLKO.1 792 CDS 100% 4.950 3.465 N CCDC38 n/a
10 TRCN0000145143 GATGATGAAATGGACGTTGAT pLKO.1 1392 CDS 100% 4.950 3.465 N CCDC38 n/a
11 TRCN0000143593 GCTAACTGTGTGAGAGAAGAA pLKO.1 1614 CDS 100% 4.950 3.465 N CCDC38 n/a
12 TRCN0000143951 CCAGCACTTTATTTCAAGGAA pLKO.1 1419 CDS 100% 3.000 2.100 N CCDC38 n/a
13 TRCN0000140770 GACACCAACAGGAAAGGCTAA pLKO.1 1942 CDS 100% 4.050 2.430 N CCDC38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537886.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14364 pDONR223 100% 92.4% 92.5% None (many diffs) n/a
2 ccsbBroad304_14364 pLX_304 0% 92.4% 92.5% V5 (many diffs) n/a
3 TRCN0000476754 TGCAGATGGTAAGCGTAGAGCCTG pLX_317 21.2% 92.4% 92.5% V5 (many diffs) n/a
Download CSV