Transcript: Human XM_011537889.1

PREDICTED: Homo sapiens coiled-coil domain containing 38 (CCDC38), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC38 (120935)
Length:
1258
CDS:
233..1150

Additional Resources:

NCBI RefSeq record:
XM_011537889.1
NBCI Gene record:
CCDC38 (120935)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121843 GAACCGTAACATGAAAGTCTA pLKO.1 382 CDS 100% 4.950 6.930 N CCDC38 n/a
2 TRCN0000140922 CAATGAGGGAACGGCAACTAA pLKO.1 654 CDS 100% 5.625 4.500 N CCDC38 n/a
3 TRCN0000142842 CTGCTCCGATTCCTAGATTAA pLKO.1 510 CDS 100% 13.200 9.240 N CCDC38 n/a
4 TRCN0000121691 GAGCAGAATCTTACTTTGTTT pLKO.1 1234 3UTR 100% 5.625 3.938 N CCDC38 n/a
5 TRCN0000144533 CAGAGATCTCTTTCTTGTCAA pLKO.1 322 CDS 100% 4.950 3.465 N CCDC38 n/a
6 TRCN0000121844 GAGTATGCTTTGTCAACCAAA pLKO.1 599 CDS 100% 4.950 3.465 N CCDC38 n/a
7 TRCN0000145143 GATGATGAAATGGACGTTGAT pLKO.1 1150 CDS 100% 4.950 3.465 N CCDC38 n/a
8 TRCN0000143951 CCAGCACTTTATTTCAAGGAA pLKO.1 1177 3UTR 100% 3.000 2.100 N CCDC38 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537889.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14364 pDONR223 100% 54.1% 52.1% None (many diffs) n/a
2 ccsbBroad304_14364 pLX_304 0% 54.1% 52.1% V5 (many diffs) n/a
3 TRCN0000476754 TGCAGATGGTAAGCGTAGAGCCTG pLX_317 21.2% 54.1% 52.1% V5 (many diffs) n/a
Download CSV