Transcript: Human XM_011537915.2

PREDICTED: Homo sapiens anoctamin 4 (ANO4), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANO4 (121601)
Length:
4026
CDS:
70..3258

Additional Resources:

NCBI RefSeq record:
XM_011537915.2
NBCI Gene record:
ANO4 (121601)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011537915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248383 GAACTTGGCTACCCGTTAATT pLKO_005 2383 CDS 100% 15.000 21.000 N Ano4 n/a
2 TRCN0000168808 GCGAGCAGTAATTGCTTATGA pLKO.1 1734 CDS 100% 5.625 7.875 N ANO4 n/a
3 TRCN0000172418 CCACAGTGCATGTTGCAGATA pLKO.1 3354 3UTR 100% 4.950 3.465 N ANO4 n/a
4 TRCN0000168400 GCTGTGTATATGCCAAGGTAA pLKO.1 1625 CDS 100% 4.950 3.465 N ANO4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011537915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13086 pDONR223 100% 79.9% 79.8% None 1_498del;1055_1056ins177 n/a
2 ccsbBroad304_13086 pLX_304 0% 79.9% 79.8% V5 1_498del;1055_1056ins177 n/a
3 TRCN0000466450 CCACAAACCCTCTGGAGTAGCACA pLX_317 14.4% 79.9% 79.8% V5 1_498del;1055_1056ins177 n/a
Download CSV