Transcript: Human XM_011538325.2

PREDICTED: Homo sapiens keratin 7 (KRT7), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KRT7 (3855)
Length:
2150
CDS:
55..1392

Additional Resources:

NCBI RefSeq record:
XM_011538325.2
NBCI Gene record:
KRT7 (3855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116348 CCTGAATGATGAGATCAACTT pLKO.1 705 CDS 100% 4.950 3.465 N KRT7 n/a
2 TRCN0000315723 CCTGAATGATGAGATCAACTT pLKO_005 705 CDS 100% 4.950 3.465 N KRT7 n/a
3 TRCN0000116350 CCCGGAATGAGATTTCAGAGA pLKO.1 965 CDS 100% 2.640 1.848 N KRT7 n/a
4 TRCN0000315656 CCCGGAATGAGATTTCAGAGA pLKO_005 965 CDS 100% 2.640 1.848 N KRT7 n/a
5 TRCN0000116351 CCGCGAGGTCACCATTAACCA pLKO.1 243 CDS 100% 1.000 0.700 N KRT7 n/a
6 TRCN0000315725 CCGCGAGGTCACCATTAACCA pLKO_005 243 CDS 100% 1.000 0.700 N KRT7 n/a
7 TRCN0000084030 CAACAAGTTTGCCTCCTTCAT pLKO.1 351 CDS 100% 4.950 2.475 Y KRT6A n/a
8 TRCN0000062387 GCAGATCAAGACCCTCAACAA pLKO.1 333 CDS 100% 4.950 2.475 Y KRT8 n/a
9 TRCN0000082891 CAACAACAAGTTTGCCTCCTT pLKO.1 348 CDS 100% 2.640 1.320 Y KRT6B n/a
10 TRCN0000116954 CCTCCTTCATCGACAAGGTAT pLKO.1 362 CDS 100% 4.950 2.475 Y KRT8P11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538325.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06505 pDONR223 100% 89.8% 82.6% None (many diffs) n/a
2 ccsbBroad304_06505 pLX_304 0% 89.8% 82.6% V5 (many diffs) n/a
3 TRCN0000478346 GCTAGCTAAGGGCTCACTTAAAAA pLX_317 23.6% 89.8% 82.6% V5 (many diffs) n/a
Download CSV