Transcript: Human XM_011538571.3

PREDICTED: Homo sapiens ankyrin repeat and sterile alpha motif domain containing 1B (ANKS1B), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKS1B (56899)
Length:
5365
CDS:
537..4292

Additional Resources:

NCBI RefSeq record:
XM_011538571.3
NBCI Gene record:
ANKS1B (56899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248244 AGGAATTGATGCCAACATAAA pLKO_005 1280 CDS 100% 13.200 18.480 N Anks1b n/a
2 TRCN0000234648 TGAGCATGAAATTCGTAATAT pLKO_005 3887 CDS 100% 15.000 12.000 N ANKS1B n/a
3 TRCN0000167412 GTCGTGTGATTACAAAGCTTT pLKO.1 3683 CDS 100% 4.950 3.960 N ANKS1B n/a
4 TRCN0000234649 CTCTCAACATTTGCCTATATC pLKO_005 3936 CDS 100% 13.200 9.240 N ANKS1B n/a
5 TRCN0000234647 TGAAGAAGGTCCCTACTATTA pLKO_005 3805 CDS 100% 13.200 9.240 N ANKS1B n/a
6 TRCN0000234646 TTGGCCACAGGAAACGTATTT pLKO_005 3334 CDS 100% 13.200 9.240 N ANKS1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538571.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12309 pDONR223 100% 31.4% 31.4% None 1_2538del;2885_2886ins102;2962_2964delCAG n/a
2 ccsbBroad304_12309 pLX_304 0% 31.4% 31.4% V5 1_2538del;2885_2886ins102;2962_2964delCAG n/a
3 TRCN0000474562 TCACTGTACAGTACAGTCAGCCCA pLX_317 16.7% 31.4% 31.4% V5 1_2538del;2885_2886ins102;2962_2964delCAG n/a
4 ccsbBroadEn_15926 pDONR223 0% 28.5% 28.4% None (many diffs) n/a
5 ccsbBroad304_15926 pLX_304 0% 28.5% 28.4% V5 (many diffs) n/a
6 TRCN0000481009 CTCTTATTGAGGCACTTGCCAGAA pLX_317 37.9% 28.5% 28.4% V5 (many diffs) n/a
Download CSV