Transcript: Human XM_011538698.3

PREDICTED: Homo sapiens signal transducer and activator of transcription 2 (STAT2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAT2 (6773)
Length:
4441
CDS:
82..2649

Additional Resources:

NCBI RefSeq record:
XM_011538698.3
NBCI Gene record:
STAT2 (6773)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538698.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000364398 AGCACTGCTAGGCCGATTAAC pLKO_005 723 CDS 100% 13.200 18.480 N STAT2 n/a
2 TRCN0000368920 TCATCAGCTTCACGGTCAAAT pLKO_005 1358 CDS 100% 13.200 18.480 N STAT2 n/a
3 TRCN0000007462 CGATATAAGATCCAGGCCAAA pLKO.1 595 CDS 100% 4.050 5.670 N STAT2 n/a
4 TRCN0000364399 TAGGACTGAGGATCCATTATT pLKO_005 1680 CDS 100% 15.000 12.000 N STAT2 n/a
5 TRCN0000007461 GCAGCACAATTTGCGGAAATT pLKO.1 330 CDS 100% 1.320 1.056 N STAT2 n/a
6 TRCN0000368921 ACCCTCCCTGTGGTGATTATT pLKO_005 1417 CDS 100% 15.000 10.500 N STAT2 n/a
7 TRCN0000007460 GCTGAGCCATAGGTCTAAATA pLKO.1 2853 3UTR 100% 15.000 10.500 N STAT2 n/a
8 TRCN0000364400 TGTCTTCTGCTTCCGATATAA pLKO_005 582 CDS 100% 15.000 10.500 N STAT2 n/a
9 TRCN0000368990 GACTGAAATCATCCGCCATTA pLKO_005 2016 CDS 100% 10.800 7.560 N STAT2 n/a
10 TRCN0000007463 GCTTCAGTTCTCTGGTTCAAT pLKO.1 1468 CDS 100% 5.625 3.938 N STAT2 n/a
11 TRCN0000007464 GCAAGTTACCATTCTGGACAT pLKO.1 1739 CDS 100% 4.050 2.835 N STAT2 n/a
12 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 3944 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538698.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01608 pDONR223 100% 98.6% 98.6% None 282_283insCAGCCCTTTTCC;1426_1449del n/a
Download CSV