Transcript: Human XM_011538782.2

PREDICTED: Homo sapiens ALX homeobox 1 (ALX1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALX1 (8092)
Length:
1319
CDS:
315..1010

Additional Resources:

NCBI RefSeq record:
XM_011538782.2
NBCI Gene record:
ALX1 (8092)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418232 AGGAGCACACCGCCAATATTT pLKO_005 976 CDS 100% 15.000 21.000 N Alx1 n/a
2 TRCN0000013151 CGCCAATATTTCATGGGCCAT pLKO.1 986 CDS 100% 2.160 3.024 N ALX1 n/a
3 TRCN0000421889 CTCCTGTATGACACCTTATTC pLKO_005 767 CDS 100% 13.200 9.240 N ALX1 n/a
4 TRCN0000427453 ATGTATCCAGCAGTAAGAAAC pLKO_005 406 CDS 100% 10.800 7.560 N ALX1 n/a
5 TRCN0000013148 GAATTGCTAAAGGTCAAGATA pLKO.1 1103 3UTR 100% 5.625 3.938 N ALX1 n/a
6 TRCN0000013152 CCACCTATGATATATCAGTTT pLKO.1 643 CDS 100% 4.950 3.465 N ALX1 n/a
7 TRCN0000013150 CCGGATGTGTATGTCAGAGAA pLKO.1 498 CDS 100% 4.950 3.465 N ALX1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07201 pDONR223 100% 70.7% 70.5% None 0_1ins285;678T>G n/a
2 ccsbBroad304_07201 pLX_304 0% 70.7% 70.5% V5 0_1ins285;678T>G n/a
3 TRCN0000474424 CCCCCCTTTGCCAATTTCCAATTA pLX_317 47.8% 70.7% 70.5% V5 0_1ins285;678T>G n/a
Download CSV