Transcript: Human XM_011538824.2

PREDICTED: Homo sapiens leucine rich repeats and IQ motif containing 1 (LRRIQ1), transcript variant X10, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRIQ1 (84125)
Length:
4419
CDS:
55..4404

Additional Resources:

NCBI RefSeq record:
XM_011538824.2
NBCI Gene record:
LRRIQ1 (84125)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167214 CAACTCTCTTAAATCTGAGAT pLKO.1 2157 CDS 100% 4.950 6.930 N LRRIQ1 n/a
2 TRCN0000166910 CACTCTCACTAACATCAGAAA pLKO.1 1892 CDS 100% 4.950 3.960 N LRRIQ1 n/a
3 TRCN0000168121 GCACAGCCTGAGTAATTGTAA pLKO.1 2553 CDS 100% 5.625 3.938 N LRRIQ1 n/a
4 TRCN0000168687 GCACTTTGTCAGTCTCAGATT pLKO.1 3547 CDS 100% 4.950 3.465 N LRRIQ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538824.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12779 pDONR223 100% 16.2% 15.5% None (many diffs) n/a
2 ccsbBroad304_12779 pLX_304 0% 16.2% 15.5% V5 (many diffs) n/a
3 TRCN0000472227 TCGGTCCGGAAGGCCGACACCGCG pLX_317 58.6% 16.2% 15.5% V5 (many diffs) n/a
Download CSV