Transcript: Human XM_011539041.2

PREDICTED: Homo sapiens nuclear receptor subfamily 1 group H member 4 (NR1H4), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NR1H4 (9971)
Length:
2112
CDS:
427..1734

Additional Resources:

NCBI RefSeq record:
XM_011539041.2
NBCI Gene record:
NR1H4 (9971)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000021604 GCCTCTGGATACCACTATAAT pLKO.1 856 CDS 100% 15.000 21.000 N NR1H4 n/a
2 TRCN0000425622 AGTGGAACCATACTCGCAATA pLKO_005 582 CDS 100% 10.800 15.120 N NR1H4 n/a
3 TRCN0000428528 ATGCAGATCAGACCGTGAATG pLKO_005 959 CDS 100% 10.800 15.120 N NR1H4 n/a
4 TRCN0000021608 GCCTCAGGAAATAACAAATAA pLKO.1 1110 CDS 100% 15.000 10.500 N NR1H4 n/a
5 TRCN0000021606 CCCAAGTTCAACCACAGATTT pLKO.1 620 CDS 100% 13.200 9.240 N NR1H4 n/a
6 TRCN0000021607 CCACTTCTTGATGTGCTACAA pLKO.1 1543 CDS 100% 4.950 3.465 N NR1H4 n/a
7 TRCN0000021605 GCCTGACTGAATTACGGACAT pLKO.1 1622 CDS 100% 4.050 2.835 N NR1H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539041.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487815 AATGACCCCCAGAGAGCGCTTGTC pLX_317 21.5% 85.7% 83.8% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000487841 CATACGGGGACCCGAGTTGCTATC pLX_317 17.4% 85.5% 83.6% V5 (many diffs) n/a
3 ccsbBroadEn_11439 pDONR223 100% 85% 83.1% None (many diffs) n/a
4 ccsbBroad304_11439 pLX_304 0% 85% 83.1% V5 (many diffs) n/a
5 TRCN0000478769 CCTGCACGGCTATTCGTGCAAAGC pLX_317 26.7% 85% 83.1% V5 (many diffs) n/a
Download CSV