Transcript: Human XM_011539492.3

PREDICTED: Homo sapiens membrane associated ring-CH-type finger 8 (MARCHF8), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MARCHF8 (220972)
Length:
6173
CDS:
798..2519

Additional Resources:

NCBI RefSeq record:
XM_011539492.3
NBCI Gene record:
MARCHF8 (220972)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011539492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073236 CTGGTCCTTGTATGTGCTCAT pLKO.1 2153 CDS 100% 4.050 5.670 N MARCHF8 n/a
2 TRCN0000434526 GACTGGACAGGTGACTATTTA pLKO_005 2617 3UTR 100% 15.000 10.500 N MARCHF8 n/a
3 TRCN0000073233 CTTGAGCTGAATGAGAGAATA pLKO.1 2794 3UTR 100% 13.200 9.240 N MARCHF8 n/a
4 TRCN0000428640 TGAGAAGACTTTGGGACATTT pLKO_005 902 CDS 100% 13.200 9.240 N MARCHF8 n/a
5 TRCN0000417073 TGAGTCATTCAAGCAACATTT pLKO_005 925 CDS 100% 13.200 9.240 N MARCHF8 n/a
6 TRCN0000073234 CCACTAACAGAGCCCAACTTT pLKO.1 2403 CDS 100% 5.625 3.938 N MARCHF8 n/a
7 TRCN0000073237 CCTCCTTCTCTCGCACTTCTA pLKO.1 991 CDS 100% 4.950 3.465 N MARCHF8 n/a
8 TRCN0000073235 CAGTGTAAAGTGTATGTGCAA pLKO.1 2295 CDS 100% 2.640 1.848 N MARCHF8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011539492.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09862 pDONR223 100% 50.7% 50.6% None 236_1081del;1642T>C n/a
2 ccsbBroad304_09862 pLX_304 0% 50.7% 50.6% V5 236_1081del;1642T>C n/a
3 TRCN0000479403 GACCACTCCAATCGCGGAGAGCCT pLX_317 40.9% 50.7% 50.6% V5 236_1081del;1642T>C n/a
Download CSV